For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:83703711+83703838 128bp ATGTCCAGGAAGCCACCAGT CTTGGCCCTTGTGTGAATGA
Mut= 128 bp
Wt= 128 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CATCTGCAGGTAGGAGGGGCCCAGATCCACAGTGTTTCAGATTCTCATCTGTAGAGCTGTAAAGACACAAACCCCATCTTTCCCAGAAGAATGCTACATCATTATGTAACTGGATGTCCAGGAAGCCACCAGTGGGCCCTGACACTCCTTACTGGCTGTCTCTGCTCCAGctcttactgtgagacacagtgctacacagcaataaatatttcccttgctcatcattcacacaagggccaagatgtggtgtaacaactcacatggtaaggaaatgagtttgagactattttgtgattttgtttagcatctatcaaagaccaattagagagaagtcacttatgaaactggaaaaaggaacctggtgatgggcaggcactttctggaaagctcttgttttcatgcatttccccattgactgcttcctcccacacccataattctagctttactgaggctataaattatttcatgagttcagccgagccagagccaacatgaagacagccacagtcttgtttctggtggctttgatcactgtggggatgaacactacctatgtagtgtcttgccccaaaggtaagtgtgttaagggcatccaagctggaaagagaggggactctagaagatcactaggaccaggggatgcattattacagggaaagCCATGTGACAACTGCTTGGATCACACTCACTCCCTTTAGTCTATATAGAGTGATCATTCTGCATTCCTTAGCGTTCTTAAAGACAGAGGCTGGCAGGAGGGGGTTTAGTTTGAGAGAAACTTGCACAGAAATCAGGACAGCTCCGCTAGTTTAGAGATGTGCCTTGCATTAGAGTCCTGTGGGAGCACTTGCTCAGAGATGAA
This mutation is a 492 bp deletion beginning at Chromosome 11 position 83,703,768 bp and ending after 83,704,259 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47559 | ATG TCC AGG AAG CCA CCA GT | Common | A | |||
| 47560 | CTT GGC CCT TGT GTG AAT GA | Wild type Reverse | A | |||
| 47561 | CTA AGG AAT GCA GAA TGA TC | Mutant Reverse | A | |||
| 47562 | Fluorophore-1 | ACA GCA ATA AAT ATT TCC CTT GCT C | Quencher-1 | WT Probe | ||
| 47563 | Fluorophore-2 | TGC TCC AGC CAT GTG ACA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47559 | 0.40 uM |
| 47560 | 0.40 uM |
| 47561 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.