For in-depth product & services help, ask our
Technical Information Scientists
Stock No: 033774
Protocol 36005: Probe Assay - Znfx1<em1(IMPC)J>
Version 1.0
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:167048317-167048420 104bp TCTGGAGTAGGAGGGGTGAG GCAGAATGAAATGCCAGGAG
Mut= 97 bp
Wt= 104 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AAGCCACCAGTTCAGTGCCTCCCTACCTTGCTAGTGCTGTACAGCATTAAGTGTTAAAGCCAGAGTCCTCTGTCCGTTTGTCCAGGTCCACAGCCTTGCTCTTAAAAACATTACACTTCTGTGCTCGGCAGCCCAAATTTTATCAGTAGCCTGCTCTTACAAGTGCAGTGAATGTCCTGTAAGCACAACTTTGCTCCCTGAGgcaccagttgagataggattacacacacaactctcacctcagatattgcacggttttataggcatctacgggtgtcagaagaccagcattgtgcgagtgggcggaaggagcaacagtgaaatcctgaagcagttcaccctgagggagctgaggaacaagcgggagttccgccgcaccctgcccatgcacctgcggagggcctatatgagtgtgagtcagagttctggagtaggaggggtgaggggcccacacagcatagcagccacttTCTAGCAGGCTCCACAGCCCTCCGCAGGACCCAGCCTCCTCCTGGCATTTCATTCTGCTCACCTTGTGGTGCCCAAGACAAAGGGTGAAGAAAGCTACCAGGCCCTTCAGTCTGTCCCTCCACACTACCACAGTGTGGAGCCTGCTCGCTGGGAAGTGGCTTGCTTTTTCCAGACAGGTTGTCCTCATATTCACTCTGTA
This mutation is a 268 bp deletion beginning at Chromosome 2 position 167,048,375 bp and ending after 167,048,642 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47552 | TCT GGA GTA GGA GGG GTG AG | Wild type Forward | A | |||
| 47553 | GCA GAA TGA AAT GCC AGG AG | Common | A | |||
| 47554 | TGC AGT GAA TGT CCT GTA AGC | Mutant Forward | A | |||
| 47555 | Fluorophore-1 | CAC ACA GCA TAG CAG CCA CT | Quencher-1 | WT Probe | ||
| 47556 | Fluorophore-2 | CTC CCT GAG TCT AGC AGG CTC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47552 | 0.40 uM |
| 47553 | 0.40 uM |
| 47554 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.