For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:45426056-45426199 144bp GCTTGTCATTGGGTTTCACC GCTCTGGCACTCTCTCCTTC
Mut= 144 bp
Wt= 144 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CACACTCATCTTAGGGGGCAGAGAGAGAGAGAGAGTGTGTGAGTGTGTGTGTTTGTGCACGAGGCCCCATCGCCTGGGCTGCTGAGAGTTTATTAGGACCTTCTTGTTCTGTTCCAGCAGTGTGTTTGTCTGGATGTTCTGCATTTGTGAGGAAGGGCTGCTTGTCATTGGGTTTCACCATGCGTGGAAATACCGAAATTAGAGAATTTTAATGCCGttttattcacgggaagcaattgtaaagatgctgttttccatagtgctcatctgttgtttattttgggaaggagagagtgccagagctagaacttcggtaattctcatactaaatggtgtgatacgggactaactcatctgtgattttttttttcccttcaagggacaaaactgcccaaagggacaatgaagaagaaacaacagatgacccccgaaagcttaagcctggagagatagatccaaacccagagaccaagccagcccggcctgacccgatagacatggatgagggtgagtggatgctggggagtgctcagctcactgtacaggactcaggccttcttggttctcctgtcctgactgttagagacccagttctgtcagtggttattcgaggaggcgtctccccgagtgtgtctgtcagtggttattccatctccccgagtgtgtctggtcctgtttttattagactgTTTTTTTGAGGATGCCCCTTATTTTCTGCTTCTTCATTTCATTTAATGAATCGAGCAGTGAAGTAGGCAGATGTCCTAGAGGCGTGAGCCTCGAAGGATCCTGTCTCATTCCCTTTGTAGAAGGAGAGGCGACAAGCTAGCATGTCGGGCCTTGCTGTTTCTTTGACTTTAGGGTGATTTCCTTTCCAGGAAAGAGCTGTGCTACAAGAGCTGTG
This mutation is a 344 bp deletion beginning at Chromosome 17 position 45,425,670 bp and ending after 45,426,141 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47547 | GCT TGT CAT TGG GTT TCA CC | Common | A | |||
| 47548 | GCT CTG GCA CTC TCT CCT TC | Wild type Reverse | A | |||
| 47549 | CAC GCC TCT AGG ACA TCT GC | Mutant Reverse | A | |||
| 47550 | Fluorophore-1 | CAC GGG AAG CAA TTG TAA AGA T | Quencher-1 | WT Probe | ||
| 47551 | Fluorophore-2 | CCG TTT TTT TGA GGA TGC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47547 | 0.40 uM |
| 47548 | 0.40 uM |
| 47549 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.