For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr15:25895129+25895234 106bp AAGCCTCACTGAAAGGTAGGG ATTCAGCGATATGCCTCTGC
Mut= 109 bp
Wt= 106 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (GTATA insertion):
TGAAGACTGCACCATGCCAACCTCCCCTCCCATACCATTGCCATTACCTCGACTTGAGCAGTCATGTTTCTGTCCTTTCTGAAGTGTGATGGTTTCCACCTCTTGTCAAATTTCATACTGACTCCTTGACAGCACTTTTTTCTTAAGTGGACATGTTTTCTTCCCACTGGGCAGGACTGTGTTTCGGAGTGTCCATCCTGCCTTTGTGATACGTAC^tcaagggttttatagactatcacctgcatccttcgcaatgatgtacgcagatactgtatgggttgacagtgtctagcacctgagatgtgagcattccgcttgcacaagtgtgggaggttgctaagctggcaaatgctcctggggagtgacagcttgctcacctttcacattttgctttccgttgcaggtgcccagctgtggagaagcctcactgaaaggtagggagtttatccttcaacaatgtggcttatggatggcagggcagtgg^CGTGGGGAGGTGATTTGAGTTGCAGAGGCATATCGCTGAATTCATGTTTTAGCGACAGTGACCTAAGTCCCTATAATGACTTGCAAGAGTGTGCAAAGTGAAGCTGAAGCTGAGGACAAGACGGGGAAGTCACTCGAGGGATAAATGCATTTCTCAGAGTGGCTGGGCAGCGGATTTGTGCGGGAGGATGCAGCAGGGAGGGAGAGGGGCCTTTCTGTTTGATGTCTTCTCTCAGATTC
This mutation is a 268 bp deletion beginning at Chromosome 15 position 25,894,926 bp and ending after 25,895,193 bp (GRCm38/mm10). In addition, there is a 5 bp (GTATA) insertion at the deletion site.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47522 | AAG CCT CAC TGA AAG GTA GGG | Wild type Forward | A | |||
| 47523 | ATT CAG CGA TAT GCC TCT GC | Common | A | |||
| 47524 | GGA CAT GTT TTC TTC CCA CTG | Mutant Forward | A | |||
| 47525 | Fluorophore-1 | CTT CAA CAA TGT GGC TTA TGG A | Quencher-1 | WT Probe | ||
| 47527 | Fluorophore-2 | CTT TGT GAT ACG TAC GTA TAC GTG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47522 | 0.40 uM |
| 47523 | 0.40 uM |
| 47524 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.