For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr6:139494649-139494777 129bp ATCATCATCTTGCCGAGAGC CATCTGATTCCTTTTACTATGTGTG
Mutant= 122 bp
Wild Type = 129 bp
Sequence
Wt sequence with deleted region in lower case
ACAGGAATAATGAAAACATATCTTAGAAATTATTGTTCTTTGGCCTTAATGAaatgggtaaccattaagtgaagcaaagaactcggaagtgcgatcactaaactttgtgcatttggttgctttacagccacagaaagcaaaatgctcactcacaagtgagctgcactgggcagatggctttctgattgtgtacgacatcagcaacaggccttcctttgcttttgcgcaagcccttatctacagaattcgggagccaccgacgactcattgtaaaaggcaagacatttccttcccattttcttctcctttctactaaatcatcatcttgccgagagcatcattagaatggatttaatacagacttccaattacaaaatttaacagccctgaacaattcaccttctCATTCCACAGGAGTTACACACATAGTAAAAGGAATCAGATGAGAATGCTTT
This is a 352 bp deletion beginning at Chromosome 6 position 139,494,690 bp and ending after 139,495,041 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47458 | ATC ATC ATC TTG CCG AGA GC | Wild type Forward | A | |||
| 47459 | CAT CTG ATT CCT TTT ACT ATG TGT G | Common | A | |||
| 47460 | CGT CCA AGA AAG ACA GTG ATG A | Mutant Forward | A | |||
| 47461 | Fluorophore-1 | TGG CCT TAA TGA CAT TCC ACA | Quencher-1 | MUT Probe | ||
| 47462 | Fluorophore-2 | AAC AGC CCT GAA CAA TTC ACC | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47458 | 0.40 uM |
| 47459 | 0.40 uM |
| 47460 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.