For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:137502483-137502610 128bp TCAATTAGCCCCGCCTCT GTACTCTCCGCCTCCTTTCC
Mutant= 130 bp
Wild Type = 128 bp
Sequence
Wt sequence deletion in lower case
GAGAACTGGGCGATCCACGCCACGCCCCTCTTGGGCCCGCCTCTGTCAATTAGCCCCGCCTCTGCTAGCTAGTCCCGCCCTTCGAAGCGCTCACTAGAACCCTGCgaaccctcaagtctcgcgagccttaaatcgccttgcgcacgcgcacgaggaaaggaggcggagagtacggaagcctagaaggccataagcttatcggttccggcttggagcggggacgcgcgtgcgcagtgcgtagcccttgctggcgagcctgcccggcgttcctcttccgatcccttctccgttcttcttctgcatatcgaggccagcgacgtccacttggatcggtcggcgaggctcacgcgagtgaagggcactgaggaaggaagaaggtaggcgtggacacgccgggaatgggaaccacgtgatgaatgaattaaaactgggagtggagaaagcggaagtggaagggcttgagacactgggaaggaagagggtgttgagggcgcccccttctggttgcacccttagaaagccgggcaagaaaggattctcctgacctccctgaatcttgttccttctccatgccaggactcagagcatggcagaaaacagagaaccccgctgtgccatcgaggctgagctggaccctgtggagtacacccttcggaagcgacttccccaccgcttgccccggaggcccaacgacatttatgtcaacatgaagactgactttaaggcccagctagctcgctgccaaaagctcctggacggaggcactagggggcagaacgcatgcactgaaatctacattcatggcttgggcctggccatcaaccgggccatcaacatcgccctgcagctgcaggcgggcagctttgggtccctacaggtggccgccaatacctccaccgtggagctggtggacgagttggagccagagactgactctcgggagcccctgacgagggtcaggaacaactcagccatccacatccgagtcttcagggtcacgcccaagtaactgaagggaggctgacttggacccaccaaggcttctgagcacacacatccatgtggccgaggtttctagtgcttcatagtggctcttgttctgagttctgtcctgagcctcttgttaccttgttacttcagcctagaggactgagaatggagagcccgagaagtgaatcttccttgtcctgtataataaattattaagttgtgttggtgccgggcttcgaatggcctctttttcctagtgtaattctgtgtgtacttgaataggaaaatggtaggaaagagcaagtatataggccacagtaaggcatctcacattgaaccacagTATGACGGGAATCAAATTTGTTGAGTGTAACACGGAAGCTTAATTGTTACAGTGTGCTCTCAGGAAGATGAGAGAGTAGACTCATCGACTGAGCT
This is a 1228 bp deletion beginning at Chromosome 5 position 137,501,323 bp and ending after 137,502,550 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47452 | TCA ATT AGC CCC GCC TCT | Common | A | |||
| 47453 | GTA CTC TCC GCC TCC TTT CC | Wild type Reverse | A | |||
| 47454 | CAT CTT CCT GAG AGC ACA CTG | Mutant Reverse | A | |||
| 47455 | Fluorophore-1 | AGA ACC CTG CTA TGA CGG G | Quencher-1 | MUT Probe | ||
| 47456 | Fluorophore-2 | TCA AGT CTC GCG AGC CTT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47452 | 0.40 uM |
| 47453 | 0.40 uM |
| 47454 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.