For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:100831468+100831600 133bp CAGGTAGGTACACCTGGAGGA GCAGGAATTGCTTCAGTGACA
Mut= 126 bp
Wt= 133 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTGGGTAAGGGGCCAGAATGAGAACAGAGCAATAAGAAATGAGGGAGTAGGGGGCATCTCTACATGTACTTTCCACACAGGCAACTCTGAACCCAGGCAGGCTGTCAGCTGAAAAGGCCCCAGAGAGACTGCTTCTAGCCTCTTTTTTTGAATAGAACCCTGGAACCCAGAGAACTAACACATATCCAAATCATACTTGCAgcccatgggcaccaggactgagggagctgcctggggtcaggctctgagggtagaaccttgatctcttgtctgtcctatctgtgtttccagctggattcaacctgttcttgtttgaggaactgttactgggccctgctgtcttcaagcaatgctgttctaccaactaactagacgtctcttttattgccttggtacaggatataccgcagggacaccatacaaggtcccaccgacccagagtaatactgctccacccccctactccccatcacccaatccctatcagacggccatgtatccaatcagaagtgcctatccccagcagaatctgtatgcccaggtaggtacacctggaggacctcttctccgggagcctccagccaggatggggtggcatgggatgaggaagaaaaaacagagttaatgggcctgGCCAGCTATCACTGTAGTGTCACTGAAGCAATTCCTGCAGGGCTGCCTGGGCTGCCTTACTCCCTAAGGGTGAAATGTCAAGTCCTTTAGGTTAACAGAGCCCCAAATGTCAGAGGGCCATTAGAAATCACCCAGCATAACTCTCTTGTTGGACAAGTGGGGAAGCTGAGACTGCAGTGGAGAAAGACTTGTCTAAG
This mutation is a 432 bp deletion beginning at Chromosome 7 position 100,831,131 bp and ending after 100,831,562 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47364 | CAG GTA GGT ACA CCT GGA GGA | Wild type Forward | A | |||
| 47366 | GCA GGA ATT GCT TCA GTG ACA | Common | A | |||
| 47367 | AAG GCC CCA GAG AGA CTG CT | Mutant Forward | A | |||
| 47368 | Fluorophore-1 | CTT CTC CGG GAG CCT CC | Quencher-1 | WT Probe | ||
| 47369 | Fluorophore-2 | CAA ATC ATA CTT GCA GCC AGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47364 | 0.40 uM |
| 47366 | 0.40 uM |
| 47367 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.