For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:83309586-83309697 112bp CAATCTTCATTTATTCTCTCCA TTCAACTCAACCAGCCCTTG
Mut= 124 bp
Wt= 112 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAAGACATCCAAATTTTAATCTTACAAACATTCTATGATCTTAGGTGTGATTGTCATAGTAATATTGACCATTTTGACTTCAAATTACTTCCACGTCATGTTCACTCCCTGTTGTTATATAATAAGTTAGCAAGAAATGAAATGTTAGAGCAATCTTCATTTATTCTCTCCATATAAAATATATATATATcttcaatatacatggttggggtttttaatctagtatatactaaagcttaagtcaagggctggttgagttgaattttcaagggaatattcttgagtaattgcctttctttccactaatgctaaagactgtctatattttgctctgaaagcttttggaaatctgtatatcaggaaattgatacataaattactcagataaaaggcttcaagtctgataatattcagagctgatatataatgcaatgactctttaaaactaattctaagtagttaccagtttcacattaatactcattgttactgtgtcatgaaatgatatttaaatattacgtcctcattgcttttactttaggtggcccatatttgagggactacatcacagttcaaagtgttgcagcttcttcaattatcacactctattttacagacttgggtcagcaagtcgggtggactacagtaagtgtccattggaGTTTAAGACCTACAATATACTGTTTTAAATTTAATGTTTATATTTTAGGCTTTTTTAAGTAATAGAAATTGAACCCAGTGCCCTACTCAAGTAAATTGAAAAGTCTGATCATTTCTGTCAGATACATTTATATTGAAATTCAACACTGCAAATATGTCTTTTAGAAAATGTTAAATTACCCTGCACACAAACTGAAGATATTTTTG
This mutation is a 471 bp deletion beginning at Chromosome 5 position 83,309,187 bp and ending after 83,309,657 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47333 | CAA TCT TCA TTT ATT CTC TCC A | Common | A | |||
| 47334 | TTC AAC TCA ACC AGC CCT TG | Wild type Reverse | A | |||
| 47335 | AGG GCA CTG GGT TCA ATT TC | Mutant Reverse | A | |||
| 47336 | Fluorophore-1 | ATG GTT GGG GTT TTT AAT CTA GT | Quencher-1 | WT Probe | ||
| 47337 | Fluorophore-2 | ACT GTT TTA AAT TTA ATG TTT ATA TTT TAG GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47333 | 0.40 uM |
| 47334 | 0.40 uM |
| 47335 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.