For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:57134845+57134969 125bp ATGAAACTGTCTTGGGAGTATAGAG GGCAAACAGAGATAGAACTTACG
Mut= 125 bp
Wt= 125 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTGTTTTAGGATGCATCAGAACTGAGGTGGGTGTTTGCAGAGAAGGAACAGCTGAAAGAGTAAGACCTTGGCGTGGGGACGGTGTGGATCCAGATCAGTAGTGCTGAAGGAGTGAAAACTGCCGGCAGCACAAAGCCGCTGGCAGGTGGAAGGTGGAGACAAAGCCAAGATCTTTAttgcctagtgttcgggagggaggggggcaggcagacagggagggtttttgtttttggttttttcctttgttttgggttttgtgtattgttgttactcttacaattggaaatagtttcattgagaaactctttaacacttggcctgtcaggttttgaaaactcaattctgttgaacagttctgttttcagtgtaactgttttcttttttcttttcatgctttcaattacagcaaaaatggaaagaagtggcccaagattgtacaaaggctgttgaacttaatcccaaatatgtgaaagccctctttagacgtgcaaaagcccatgagaagctagacaataagaaggagtgtttagaaggtgagggcatttctgtattttcctaggaaaaatactgaaggctttggagtcactagtaaatttatatgaaactgtcttgggagtatagagatcagctaattgtctttcagggttaaactacaccacggttgagactttgTTCTCTAATTAAATAGAAATTACTGGTACGTAAGTTCTATCTCTGTTTGCCACTGTGTAATATTTATTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTTTTGGGGGGGGCCATGGACTCTCTTCGTAGCCCTGGCTGTCCTGGAACTCACTGTGTAGACCAGCTAACATCAAAC
This mutation is a 496 bp deletion beginning at Chromosome 16 position 57,134,423 bp and ending after 57,134,918 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47195 | ATG AAA CTG TCT TGG GAG TAT AGA G | Wild type Forward | A | |||
| 47196 | GGC AAA CAG AGA TAG AAC TTA CG | Common | A | |||
| 47197 | GCT GAA GGA GTG AAA ACT GC | Mutant Forward | A | |||
| 47198 | Fluorophore-1 | CAG GGT TAA ACT ACA CCA CGG T | Quencher-1 | WT Probe | ||
| 47199 | Fluorophore-2 | AGG TGG AGA CAA AGC CAA GAT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47195 | 0.40 uM |
| 47196 | 0.40 uM |
| 47197 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.