For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:32497642+32497774 133bp ACCTTCTTCAGTCTCGTCTCG GATGTGCGAGGTTGGAAGTG
Mut= 133 bp
Wt= 133 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GAGTGGCCTTTTCTTCGGATTCCCGTGAGTGTCCCATGTCATCCGTTAGGTTCCTTACACGGGGACAAGAAATAAAAAATAGTGCAGAGGCAAGGGATTTGCAGGAAGGTGTGCTAGAAGGCCTGGGGAACAACAGTCTAGCTACAGAAAAAGAAATGCGCAGCCATAGAATCctggaggattggtgtatggcgggggcaggtaaaagtagctggtgctgctgctgctggcatttggtggggggcccctgggagtctgtcccttgcctggatacttagagtgcgaggcctgatccagctggacggggcctgggggaggagctctcagctactccagctccaaaactgaaggaggctctggtctcagttgtaggtggctggttcagaacggggagtgggcctttcctgccatcacaggaccactcttcatcctcaccttcttcagtctcgtctcgctcaacttctcagaccctggtatcttacatcgaggtgagggaggaggactcagcccccctGGAAGGAGCTGGTACCCTGAAGGCTGGCACCCCACTTCCAACCTCGCACATCAGGACTTCTTTACCCCATGGCAACATTTCCAAGATCCTGTATGGTTTCCAGTTGCTTCAGAAGAGCGGGCTGTCCAGGCTGGAGAGAGAAACCAGTGGGCACTCCCTCTTCCACTACACAGAAC
This mutation is a 341 bp deletion beginning at Chromosome 16 position 32,497,382 bp and ending after 32,497,722 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47179 | ACC TTC TTC AGT CTC GTC TCG | Wild type Forward | A | |||
| 47180 | GAT GTG CGA GGT TGG AAG TG | Common | A | |||
| 47181 | AGG GAT TTG CAG GAA GGT GT | Mutant Forward | A | |||
| 47182 | Fluorophore-1 | CAT CGA GGT GAG GGA GGA G | Quencher-1 | WT Probe | ||
| 47183 | Fluorophore-2 | CGC AGC CAT AGA ATC GGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47179 | 0.40 uM |
| 47180 | 0.40 uM |
| 47181 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.