For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:75888482+75888621 140bp GTGGGCTTGGCTGATTCTG ACACAGTGAGACCCCCATTC
Mut= 135 bp
Wt= 140 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGCCCTGTGCCTGCCTATTCCCTGTTTCTAAATGTTCCTTTGTTCTCAGTAGGTTGTAATCGGAGGGTCTGCATTGGAGGGTCTGCATTCCAGTCTGCCTGTTCTCTAAAGGTGTTTGATTAGGGTGTTAACCTGGTTCTTCTCAGTTTAATCCAGcagtgctggtggtgcccagtgggatctttagggaatgaatggaagccattcctgggtcaggtgcaagagacaccccggtccagacctaaggaaagccaaattgtagtcccaagtgtcaaatactgaactcagtcgtgtttagagctcatttcacccaaagtcctttgccagtgctaaagagtagttgccgagtagcatgtgctagcgtgtcagttaataactgcgctttccacagattgagaagctcgctcagactctgtcttgcgattacaatcaaccttcaccggaggttgtgagcgtggctgcctcatctcctacctcaagtcctcccactaagaagtgctccaaggctcaagctcaggcaagatggcagtggtctgccaagaaggctcttctgcagtgggctcaggagcagtgtgccaggtgagtagtttgctgtgccagatgagacagctgtgtccttccatccacacaacctcatggacttctggctctgacagtcgggctgatagtacactcccagcaacaccgtttcttagtgaatcttccagaagtggatcttggtgggcttggctgattctgctttgagaggtggcagctttaccctggttgctggctttccattgtttattgctgtgagCAGATAAAGAATATTTAAGTTTTCTAACTCCCCTTCCCTTTTTGAATGGGGGTCTCACTGTGTGGCTCTGGCTCTCCACAAACTCACACCCACCTACCTCTGCTTTATATATATGCTGGGAATAAAGGCACACACCAGCATGCCTGGCATTAAATATCTTTTTAAGGTACAGTTCTCCCATGC
This mutation is a 640 bp deletion beginning at Chromosome 12 position 75,887,919 bp and ending after 75,888,558 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47173 | GTG GGC TTG GCT GAT TCT G | Wild type Forward | A | |||
| 47174 | ACA CAG TGA GAC CCC CAT TC | Common | A | |||
| 47175 | GCA TTC CAG TCT GCC TGT TC | Mutant Forward | A | |||
| 47176 | Fluorophore-1 | CTG GTT GCT GGC TTT CCA | Quencher-1 | WT Probe | ||
| 47177 | Fluorophore-2 | AAG GTG TTT GAT TAG GGT GTT AAC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47173 | 0.40 uM |
| 47174 | 0.40 uM |
| 47175 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.