For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:119578941+119579060 120bp GACCAATGGAGAAAGGAGGA CTGGGATTGCTGCTGTGA
Mut= 103 bp
Wt= 120 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCAGTCTACCCGAATCAGTAGTCTCCAAGTTCAATGAGAGAGAGAGTTCATAGTTCAAAAGCTATGGCAGATATGATAGAGAAGACAGCTGGTGTCACACCTCTGGCCTCTGTGTGACCTTGCATACCCAGGAACACACACAAACAGACCAATGGAGAAAGGAGGACGAGGAGGACccgatgtgaggcttcagattgaaaactttagacagaatggatggagaaaagagcctgagcgggtgccatggctcacagcagcaatcccagcggtggcgcaggcaggagagccacaagcttgaggccagcctgggttacctactgagttcccagctgaccctgtctccaaactaaatggagccaaatacaaacccttaactattttttttcacagacgacaagctgaagtgagcgtcttgtgttttgcttttcaacaggatgacgaaacagttccttcaaaagctctgcaagcagcacaagctgtacgtcacccccgccctgaacgacaccctgtatttgcactttaagggtgagtcccaggcgagtctatagccagcgtcctgcagaaaggggggagctggagagcatggcttgcagaggttgtcttcgcgctcagacgctatgcaagtggagctcggtcttgactgagttcctaaagggcCTTCTGAGTACAGTGGAGCTGGCCCGCCTTCTTTGGTTGCTTGGTTTTTTTCTTCCTTGCAAAATAGGGATGGAACCCAGAACCTCAAACATGCTAAGCAGGCACACTGCCACCAGATACAACTTCAGTTAGCCCGCCTTCCCCATTTTATTTTGAAACAAGGCTCACCAAATTGCCCTGGC
This mutation is a 481 bp deletion beginning at Chromosome 8 position 119,578,971 bp and ending after 119,579,451 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 47018 | GAC CAA TGG AGA AAG GAG GA | Common | A | |||
| 47019 | CTG GGA TTG CTG CTG TGA | Wild type Reverse | A | |||
| 47020 | CCA TCC CTA TTT TGC AAG GA | Mutant Reverse | A | |||
| 47021 | Fluorophore-1 | ATG GAT GGA GAA AAG AGC CTG | Quencher-1 | WT Probe | ||
| 47022 | Fluorophore-2 | AGT ACA GTG GAG CTG GCC C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 47018 | 0.40 uM |
| 47019 | 0.40 uM |
| 47020 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.