For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:63030174-63030281 108bp AAAAGAGGTATCTGTTGCATGG CTTTTGATAGCACCGAACCA
Mut= 96 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAGATGTGTTCTAGAAGGTTCTAACAAATTGAGAGGTCATTGTCTCATCCTTACTCTATCTGCCTCACTCTACCTGCCTTGGCTTAGTTACTCATACAAACTCTTTTCACCCGCAAACGTCTCCACTCTCCTAGGACACTCACAATTCTGTACAAGCTTCCTTAGACATAAATCCCTTGgctttccaacgtcaagggattgaatgttggaagggacactgtaagaaagacagccagttggcccacccaagatgctagctagcctcagctgtcatcttctcttcttctaacagtgtcatggtctatgggacgaggatgacattgttgacagtaacacagacaaggaaggatcggatgacgagctgtccctcgatcagggcagaagaggctcctcagactcactgaagtctatcaacctggctgcctctgtagagtctgtccacgtgaccttccccgagcagccagcggccatcaggagaaaacgctcctgcagtagctctcagatctccccacggtccagcttctcttcaaataggtccaaaagaggtatctgttgcatggccattaggttgaaatgagccccacatagtctcattgATCTGGTGCCTCTGCATCTGGGGAGGGAAGTGGTTCGGTGCTATCAAAAGACGATGTTGTGACATGGAAGAAACATGCTCTGGCATATGACAGACCCAAGTTCAGAACCTGTTTCATCTGTATGTAGCTTCATTGTTCAATATGTGTGAGTCCATTCAGGGACCAGGATTTGGCCAGCACATAACCTCATAACCTA
This mutation is a 417 bp deletion beginning at Chromosome 18 position 63,030,224 bp and ending after 63,030,640 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46902 | AAA AGA GGT ATC TGT TGC ATG G | Wild type Forward | A | |||
| 46903 | CTT TTG ATA GCA CCG AAC CA | Common | A | |||
| 46904 | GGA CAC TCA CAA TTC TGT ACA AGC | Mutant Forward | A | |||
| 46905 | Fluorophore-1 | AAA TGA GCC CCA CAT AGT CTC A | Quencher-1 | WT Probe | ||
| 46906 | Fluorophore-2 | AAT CCC TTG ATC TGG TGC CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46902 | 0.40 uM |
| 46903 | 0.40 uM |
| 46904 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.