For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr16:11128273-11128378 106bp CCTTGTCAGGTGCAAAGC CAAGCACACATCTCCTGAAGC
Mut= 114 bp
Wt= 106 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AACTCCCCTTAATAAATTATGTTTTCTAAAAGTTGAGTCACCTGTAAATGTCTCCTATAGGAACTGTACTCATGGTGCTGTATACGGTTTCCTCAGACTTGTGAGCAATAGAGCAGTAGCAGCAGTGCCTGGAGATCAGTGGCTTTTGTTGACTGTCGGGCTACAATGTTGAAATTTTGGGTTGTGAGCGGTGAGACcgtggagcgtgtcattatttactgcttccctaacccacacctgcagggacaatgcccagcatctgtactgtcccagccaggtgttgccttagcatggtgtattggtttctgttcagggcggtgacttgcaagctcttaatttcttactcaaaagaggcctttaaaaaaagtcttctctcttcttccgtacaaaagtgtaatggaagaaaataagtaagtggagaaattgtttgtgtttactcttttttagtcgagcaaaagacgtgataataccagcaaagccgcctgtcagctttttctcctcgagatctccggtccttgacctcttccaggggcagctggactatgctgaccatgtccgccaggattctgaggtggtggtgctgttcttctatgccccgtggtgtggccagtccatcgctgccagggcagaaattgagcaggcagccagccggctttctgatcaggtaatgtgtgctttcacccaagcggtgactgtcaagtctatattagagaagatggcctctcagagaaatgatgccagactggccgtgatatccaggcaaactccggggccttgtcaggtgcaaagcttgtgaagaaacaggaacaagaatcctggcatgaggtcAAGTGGCAAGAGTAAGCTTCAGTTCTGTAGCTTCAGGAGATGTGTGCTTGCCCAGGATACCAGGTTGTGGGATACAGTGCTGAAGATAGTAGAGACCAAGAACCCCAGCTCTCTCATGTCCAGCTTATGTGGCTTGTAAGCCTTTTATGTTGTAAGTGGCACACAGGCCATGGTGAATGTG
This mutation is a 631 bp deletion beginning at Chromosome 16 position 11,128,323 bp and ending after 11,128,953 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46870 | CCT TGT CAG GTG CAA AGC | Wild type Forward | A | |||
| 46871 | CAA GCA CAC ATC TCC TGA AGC | Common | A | |||
| 46872 | GAT CAG TGG CTT TTG TTG ACT G | Mutant Forward | A | |||
| 46873 | Fluorophore-1 | ACA AGA ATC CTG GCA TGA GGT | Quencher-1 | WT Probe | ||
| 46874 | Fluorophore-2 | TGA GCG GTG AGA CAA GTG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46870 | 0.40 uM |
| 46871 | 0.40 uM |
| 46872 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.