For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:80897707-80897813 107bp TTCTGTCTACTACATGCAACCAAG GCTGGGGTGGTAAACTCAAC
Mut= 101 bp
Wt= 107 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTGCAGCATCTGTCTTTATCAGCATGCCCACTTCTCAGGATACAGACATAGGTGGGTGTACCTGGGGCATCTGAAGAAATTGTTAGCTTAGCAGACATTTTGACTAGTAGAGCCTACAAGTCCGTGCAGTTGCTCCAGGGGCCAAATGCAGACTGGAAAAGCCCTCTGAAGCTTGTCTGAAAGCTGACAGACGCCACAGAAGTTCAGgttttagtcggggttctgtgttcaggcttcctacttgtgacctttctaggtgaccatcatgacctgtggcagcctgggctaagtctgtggctttcttgagttgtgatcctgtccctaaagcaggatgagcctgctcatgtgttggacgagggcagctggtcccagggctcccaagtgggctagagaggaaaggctgctgtagggagggcaagcttccatgtctgctcttaagattccccgtctctctggaacaggttgctggtgaccagtggacttccagggtgttacatacaaatgtggcaagtcagagaggacaacggtgagtaaagttcacggggtggaaggtgaggttttaggaaagtgactcacacactcctgtctcttagcagagccaggaaaaaagcacttaagccaggggacagcacagtttctgtctactacatgcaaccaagatgagttagcatccatagtgtagcagacagGCCTACTAGGGCCTCCTTGAACTTCCTCCAGGAGTTGAGTTTACCACCCCAGCTGCTGGCAGAGCACCTAGAGAGCCAGGACCTCCCTGCTGGACGTGGGCAGAGGACGGGCTGAGCTAGAGCCACTGGGGCACTCAGCT
This mutation is a 482 bp deletion beginning at Chromosome 7 position 80,897,760 bp and ending after 80,898,241 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46833 | TTC TGT CTA CTA CAT GCA ACC AAG | Wild type Forward | A | |||
| 46834 | GCT GGG GTG GTA AAC TCA AC | Common | A | |||
| 46835 | AGC CCT CTG AAG CTT GTC TG | Mutant Forward | A | |||
| 46836 | Fluorophore-1 | AGT TAG CAT CCA TAG TGT AGC AGA CA | Quencher-1 | WT Probe | ||
| 46837 | Fluorophore-2 | ACA GAA GTT CAG GCC TAC TAG GG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46833 | 0.40 uM |
| 46834 | 0.40 uM |
| 46835 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.