For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr12:111425084+111425173 90bp GAGAGGAGGTAGCTGGTGGA GGAAGTCAGGACTGAAAAAGCA
Mut= 90 bp
Wt= 90 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GATTTCATTACGGGCGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAGACCAGCCAGTGCTCTTAACTGCTGAGCCATCTCTCCAGCCCCATGACTTTAGACTTTAAGCCAGGTTAGAGAGAGGAGGTAGCTGGTGGAGCATCAGAGGTCCGCCTGGgtcctaacaactccctcatcccggaatcttgctttttcagtcctgacttcctgggcgccccagacttggcgctgcccaccgagccgctgcccccacttctagagcctgctctgtgggctcgactggaaagtgactacactagcttcctagaggtgaggctggggaggccccgggctccagaggttgggtcctacaggaggtttgatgtggaggataggggttgtgctggcagtggtcctgtaagcgatggaccatgactggagtccggtgacgctagtccttgaaggcgcaaaatggagtttggtaggcagggggcgcccttaccttcctcctggaaagcttctcaccacaggccactcctaaccctacagaccaagatcacaagctgttttgacagcatcttgcagctggaacagaatcgctgggaagccgacgaggaccgggaagtactgcagggcctctaccacgcgcccctgtccatcgatgtgcacatggtgcgcccgggagggggtgaaggaagggctatgttcaggactcaggctcatgtcggagatccctcagagctaagttttactgagagaggaacctgtggAGTGATCTAGACTCTTGGGGCACATGGCCAGGTTAAATCACAGCTCTCGGGTCTGCCGGTGAATTCTAGTAGCTGTGTGGAAGGGGGGGAGGTGACTCTCACATTGGGGCCACTGAAAACCTGCAGCGATGGGGTGGGCTGGGTTCGGGACTCAACTGCTCTCAACATGTGGCATCCCTGGCAGCTGGTAGCTGAG
This mutation is a 592 bp deletion beginning at Chromosome 12 position 111,425,123 bp and ending after 111,425,714 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46828 | GAG AGG AGG TAG CTG GTG GA | Common | A | |||
| 46829 | GGA AGT CAG GAC TGA AAA AGC A | Wild type Reverse | A | |||
| 46830 | CCC GAG AGC TGT GAT TTA ACC | Mutant Reverse | A | |||
| 46831 | Fluorophore-1 | AAC TCC CTC ATC CCG GAA | Quencher-1 | WT Probe | ||
| 46832 | Fluorophore-2 | CCG CCT GGA GTG ATC TAG ACT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46828 | 0.40 uM |
| 46829 | 0.40 uM |
| 46830 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.