For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:65375590+65375751 162bp ACTTTTGTAATGTGCTGTGTCC CCTGCCACTCAAAGCCATC
Mut= 164 bp
Wt= 162 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ACTTGGTCCCCTTGTACCATGCAGGCCTCTGACTCAACTTTGTCAAGCTTCATAGTAGGTGCCTTTACAGATGCAGCTATTTTGCTGGCCCCAAATCAATAATTTGTGGTTTGATATAAAATGCTTGATATTTAGGAAAAGAGTTACTTTTGTAATGTGCTGTGTCCTGgcactttgtaaacgaactagaatgttttagtcctctgaaaatcgctgcttccttttctctgtgcagcaataaaatttgatgaaatccgcgtgtttggttatacggcctggactctcctggatggctttgagtggcaggatgcctatacgacccgacgagggctgttttatgtggactttaacagtgagcagaaagagaggaaacccaagtcctcggctcattactacaagcagatcatacaagacaacggcttccctttgaaagagtccacgccagacatgaagggtcggttcccctgtgatttctcttggggagtcactgagtctgttcttaaggtaagtggctacagctgaattaaccacgcaccagGGGAGATAGTATACAGTATGGTTTTTTGTTTTGTTTTGTTTTACAGTATGTTTTTACAAGTGTAAAATACATGTAAGGATATCTTAGTCATTGTTCTGTTGCTGTGAAGAAACATCATGACCACAGCAAGTCTGGGGTCTTCAATTGGGGCTGGTTCACAACTCATCAGCATGGTGAGAA
This mutation is a 369 bp deletion beginning at Chromosome 5 position 65,375,614 bp and ending after 65,375,982 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46801 | ACT TTT GTA ATG TGC TGT GTC C | Common | A | |||
| 46802 | CCT GCC ACT CAA AGC CAT C | Wild type Reverse | A | |||
| 46803 | AGA CCC CAG ACT TGC TGT G | Mutant Reverse | A | |||
| 46804 | Fluorophore-1 | AGT CCT CTG AAA ATC GCT GCT TC | Quencher-1 | WT Probe | ||
| 46805 | Fluorophore-2 | AGT CAT TGT TCT GTT GCT GTG AAG AAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46801 | 0.40 uM |
| 46802 | 0.40 uM |
| 46803 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.