For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr13:23814789+23814898 110bp CGTTTTCAAATCAGGACGTT CTGGGTCTCTGTGCTCCACT
Mutant= 99 bp
Wild Type = 110 bp
Sequence
Wt Sequence (deletions in lower case):
CCTAAATCAAACTAAGTATTTATAATAGAATTATAATAGATTTTCTTGAATTCAGAACAACTTTAGTTGTAAAGTCGTTTTCAAATCAGGACGTTTTAGCAAAGAGGgtgcccctactaactaagaaccctaaccctttctgtcttttccaggctgctgtctatcagtggagcacagagacccagggcattatctttagctccatcagctatggaatcatactgacgttaataccaagtggatatttagcggggatatttggagcaaagcagatccttggcgctgggttgctcatctcatccctgctcacgctgtttactccactggctgctgactttggggtgattttggtcattgtcattcgcacagtccaggggatggcacaggtatctcgctactattctcagaccgagtcgggtacagattcgcgacatctgcaaaacaacaaaggtctcaaccactttcattgcagggaatggcctggactggtcagttcacaatttgggcaaagtgggctccgccacttgaacggagcaagctcaccagcattgcgggttcaggtgaggacgtgtaagtgcgtcagtgggtggtgctttgctctgttcttctgtgacgcaggtgatttcaatattcaagaaaaaaatagagcaagatgtgacaattgcttaacaaaggagaaacatacatctgtgatgtagagcctcaggcttaggaggaaagcactgtgacctacatcagtcaaaggctGAGGCCTGATGGGAAAAAAAAAATACTGAGCTTTATGACAGGTAGAAATGGAATTAGTCATAGTGGCTATTGTCTGTCATCCTAATACTGAGGAGGCAGAGGCAGAAGGATTTCGAGTT
This is a 640 bp deletion beginning at Chromosome 13 position 23,814,821 bp and ending after 23,815,460 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46754 | CGT TTT CAA ATC AGG ACG TT | Common | A | |||
| 46755 | CTG GGT CTC TGT GCT CCA CT | Wild type Reverse | A | |||
| 46756 | GCC ACT ATG ACT AAT TCC ATT TCT ACC | Mutant Reverse | A | |||
| 46757 | Fluorophore-1 | CAA AGA GGG AGG CCT GAT G | Quencher-1 | MUT Probe | ||
| 46758 | Fluorophore-2 | TCT GTC TTT TCC AGG CTG CT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46754 | 0.40 uM |
| 46755 | 0.40 uM |
| 46756 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.