For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:123041283-123041372 90bp AAAGATGAGGCACAGACCCTA CCTGAAGCTGGAAGCCACAT
Mutant= 100 bp
Wild Type = 90 bp
Sequence
Wt Sequence (deletions in lower case):
GATGAGGCACAGACCCTATTCTGAAGAAAACTGTTCAGGGCAGAGATTCCccgaggtctggactggcatgtggcttccagcttcagggtggcagccatctgcagtgttggcccatccgtgtgtcaccagggaaaggaacacaggtctggaagaagagtggtgcggtctatgaaggggattggaagtttgggaagcgagatggttatggatccctcagtcatcctgacccagagaccggaaaactcaggagagtgtattcaggctggtggaaaggcgataagaaatcggtgagtggtttcccagcatgccttgtttgtaggcgaggggaagagccaggctttgtgtggggggtcgggggtgaaggtgggaggtggaccgagagacagtggcttgctgggtgggagaaggaaggggtggagggagggactgtagtgcttttcaaaagaaaacaggaaacaagagaagtggcaggccccaggaaggaaccctttaaaaaccttacagcttcAAGGAGGCAGCAGGCAGTCTCCCCCACCCTCTTCCTCCTGGTTTCCTGGCTT
This is a 458 bp deletion beginning at Chromosome 5 position 123,040,862 bp and ending after 123,041,319 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46717 | AAA GAT GAG GCA CAG ACC CTA | Common | A | |||
| 46718 | CCT GAA GCT GGA AGC CAC AT | Wild type Reverse | A | |||
| 46719 | AGG AAA CCA GGA GGA AGA GG | Mutant Reverse | A | |||
| 46720 | Fluorophore-1 | ATT CCC CGA GGT CTG GAC T | Quencher-1 | WT Probe | ||
| 46721 | Fluorophore-2 | AGA GAT TCC AAG GAG GCA GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46717 | 0.40 uM |
| 46718 | 0.40 uM |
| 46719 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.