For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:26629464+26629557 94bp GTGTTCATGGAGGGCAAATG CCACTGTGAGGGACAAAGAGA
Mutant= 109 bp
Wild Type = 94 bp
Sequence
Wt Sequence (deletions in lower case):
GAACTGTTTGGGGTACTGTGACTCATAGCCAAGCAACCCCCTTCTCCCCTACTGGTTGACTTCCCATGTAGCCTGGGTTTCCTGGGCATCGTGTTCATGGAGGGCAAATGGGGCCTCTGTagaagcgggctgctccccactctacatgggtgtgggtaactgctctctttgtccctcacagtggtcgggcttgacatccaagatgagatgggcagacacgaagtgggccacatcgacaattccatgaagatcccgctgaataatggagccggctgccgcttcgagggccagttcagcatcaacaaggtacggagggaggcactgcctgggcccttttcctgccccctgcccactcgaccctaacagagtcagcacatgactgccgagaattttcctgagactgggtaggctctgcattccctgagattctagagcctctgatggtgggttcagaaagagctgcccctcgctggagtggaaattacCAAGGGAGGTGAGACCTGGCTTCAAGTCCTCTTCCTCCTCAGCAAGCAGTGGCCACAGGACATTGGGGTTTACAGCTGCGATGACAGCAATGCCACAGTGGCATCCACCACGGCACAAAGCCCACGGGTGCAAATGAGAGAGCACACTGTTCATTCCAGGCCTGTATACGCACCTTGCATCAGAGTCAGATC
This is a 365 bp deletion beginning at Chromosome 17 position 26,629,494 bp and ending after 26,629,858 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46707 | GTG TTC ATG GAG GGC AAA TG | Common | A | |||
| 46708 | CCA CTG TGA GGG ACA AAG AGA | Wild type Reverse | A | |||
| 46709 | GCA GCT GTA AAC CCC AAT GT | Mutant Reverse | A | |||
| 46712 | Fluorophore-1 | CTG CTC CCC ACT CTA CAT GG | Quencher-1 | WT Probe | ||
| 46713 | Fluorophore-2 | CCT CTG TCA AGG GAG GTG AGA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46707 | 0.40 uM |
| 46708 | 0.40 uM |
| 46709 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.