For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:92865160+92865264 105bp CATGAAATGTCTCCAATAGCTTC CTAGTCCTTTGATCAGGCACA
Mut= 96 bp
Wt= 105 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GTGACACACCTACTCCAACCAGGTCACACCTATTCCAACAAGGCCACACCTCCAAATGGTGCCACTCCCTGGTCCAAGAATATACAAACCATGATAAATGTCCTATCTTGTGTACATATTTGTTTGTGTGTGTTTATATCTCAGTCTCATGCAAGGCATTTAATTAATTCACCcttgagaacatgcaggaaaccaaaaactttcctgttacttacttttttttttttttttttttttttttttttggtcaactttggtttgcagatgtttcttcttggaattattctgctcccagtccgtgctttactggttggaataattttgctgctcgcatggccatttgctgtcatttcaacagcatgctgtcctgaaaagctgacccatccaataagcaattggaggaggtaagtggtaatcatgtccaaatattacacaaatcaaaacttttaaagtttctccaatgaccagtttttgtgaaggatattcatctttggttctaaagagcccctgggatatgttttaacatgaaatgtctccaatagcttcatgcattagaggctttattgacagccaatgggCTTTTGGGGAGTGACTGTATCTTGAGGGCTGTGCCTGATCAAAGGACTAGTGCCTTTATGGATTCATAATATGATGGCATTATAAGGAGGTGGTGAAAATCGGGGGGGGGTAGCCTAGTTGGAATAATTATGTCAATTACTAGGAGTATGTCCTG
This mutation is a 405 bp deletion beginning at Chromosome 8 position 92,864,810 bp and ending after 92,865,214 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45596 | CAT GAA ATG TCT CCA ATA GCT TC | Wild type Forward | A | |||
| 45597 | CTA GTC CTT TGA TCA GGC ACA | Common | A | |||
| 45598 | GTG TGT TTA TAT CTC AGT CTC ATG | Mutant Forward | A | |||
| 45599 | Fluorophore-1 | CAT TAG AGG CTT TAT TGA CAG CC | Quencher-1 | WT Probe | ||
| 46568 | Fluorophore-2 | AAT TAA TTC ACC CTT TTG GGG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45596 | 0.40 uM |
| 45597 | 0.40 uM |
| 45598 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.