For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:127796380+127796470 91bp CCCCTACACCATTGTACTGTGA GCCCTTTCCTCTTGCTTTGT
Mutant= 107 bp
Wild Type = 91 bp
Sequence
Wt Sequence (deletions in lower case; bp changes in brackets with wt first and insertions with carrots ^g^ (g insertion):
GTCCAGGCTGGGCTTGAACTAACGATCTTTCTGCCTTAACTTCTCACCACCACATACTTGATTTAATTTTTAATTACAACCATCATATTTTTTTGTTTACATCACTATTTAAATGAGAAAGGAGTGAGACTTCCCTCTGCTTCCCCTACACCATTGTACTGTGAGCAATCTCATAACcgtccacattataagactgggcaaaggagaaatgaaacaaagcaagaggaaagggctagtattgttcttactataggatcccctaccgcattttgagcacactctttgagagggcagtacaggctgaactaaccgcatgctttgaccattgcaggccggggagcgtcatgtccacctttgaagacgctgatacagaggagacggtcacttgtctccagatgaccatttaccatcctggccaacaaagtgggatatttaaatcaataaggttttgcagcaaagagaagtttccttccattgaagtggtgaaatttggacgcaattccaacatgtgccagtatacgtttcaggacaaacaggtgtcccgaattcagtttgttttacagccgtttaaacagttcaacagctccgttctctcgtttgaaataaaaaacatgagcaagaaaaccagtttgatggtagacaaccaggagctcggctacctcaataaaatggacctgccttacaagtgtatgctcaggttcggagagtatcagttcctgttgcagaaggaagacggagagtcggtggaatcttttgagactcaatttatcatgtcttcaagacctctcttgcaagaaaacaactggccaacacagaatcccataccagaggatgggatgtattcttcatacttcacccacagaagttctccttcagaaatggatgaaaacgaactgtgaagagggtccaactggagacacattgaaggatgaggacacatgggtcggatgtcaagagacatcctacttccgagtttgtgagtgtagcgtagcgcggctgtcctcatgctgactttcgttttggtaatagcatttggaagtctctagactgtgttaatcatcaacttagtcaactgagtttcggctctacaaagaattaagtgtacatctgtaagggttggtgcatcagacacgtcttctgggtaatgaggtcacccttgttgcttttctgcatgatgttacccccatgctttgtcttggtggcagccatctcttggcccggtcacatcatttcgtagcagcctttgtttttcaggtttagagctcgggcagattgctcactggtgtctgtggcgtgctagcgcttgtagaactagagtcctggaataagttctagagtgctgagtcactgagtcaccatggcttccttatggaaagacttgggaaatagctccttgattttctttctgtggaacggtagtgtcgctttcctatatgtaggacctacaacaaacatttaaagaacactgagatgaagatggttttcttacaatattgaaagtgaattttatgtatctcacagatttaaaaatggcagaaatcaaaacttttaacagcctctttgcacatgataaagccggagcccagttccttagttgcttctttggaacttcttaaaggaaaacatgtattcttaaaggaaaacatctattcttaggctgccctatagaagtcagtacctgtgaatatttatattaaatgcttaattatttctaaaattttagtttcacataaagttgtatttatttaaaagattctcattcacttcattttggctagattaagatgaatgttagtgaacattatgtaaaagaggatgaaagccattaagttaagataaattctagcattactagtaagtaaggcaccctgtatagcttcctctgtaaatgaaatttaatgctgtaacaggtacaggattttgggtaggggaggaggtcaggtgggggaagttagccacattcatattttgtttttgtttttgtttttgtttttgtttttgttttccaacaatagcttgctttgaagctcaggctggcttggaactcttgatcctcatacatcggccccctgaatgctgtgcctagcttaatgtaactgtatttctgcaacagccctttgaaattatttctaataaactgtttggcctagtaccatgtgaatgttatctgcagtatgcctcttgctgcagatcacCAGTCAGTCACCCCTTGCCTATAAAATAAGACATCAGCTGCTGCCTCAGCAGGGATTGCTGCTATAGGCAACCCTTTATGTGCTAAGTGTCCAGGTGAGTATTTCATTTCTTGCCTTGTTTTCCTGCTGACTCCCGTGGTAAGCTGTTGTGTGTAGCTTTTCACTATCCTAGCTATGCTCTGGGAATCAGACTGAACTACCAGCCCCCTCCCAGCTTCCCTTGAATCCATGGATA
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCAGTCTTATAATGTGGA and GACTGGTGATCTGCAGCAAG, which resulted in a 2018 bp deletion beginning at Chromosome 3 position 127,796,415 bp and ending after 127,798,432 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001352154 (exon 3) and 197 bp of flanking intronic sequence including the splice acceptor and start of translation and is predicted to result in a null allele.
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46353 | CCC CTA CAC CAT TGT ACT GTG A | Common | A | |||
| 46354 | GCC CTT TCC TCT TGC TTT GT | Wild type Reverse | A | |||
| 46355 | GTT GCC TAT AGC AGC AAT CC | Mutant Reverse | A | |||
| 46356 | Fluorophore-1 | CCA CAT TAT AAG ACT GGG CAA AG | Quencher-1 | WT Probe | ||
| 46357 | Fluorophore-2 | CAT AAC CAG TCA GTC ACC CCT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46353 | 0.40 uM |
| 46354 | 0.40 uM |
| 46355 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.