For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:163704109-163704204 96bp ATAGGAAGGGTCAGCAAGCA GTAGCTCTGGGCTTCAAGGA
Mut= 98 bp
Wt= 96 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TCTTCATAGAGTTCTTCGTGGTTCACTTCTTGGAGAAAATTACCTTGAATTGGAAGCCAAGATAATAGTTTGTGATTCTTGTTAAAGAGATAAATTTGGGAAAACCAAGCAGAACTATAAGTATTTGGCTTTGGGGGGGGAGGGGAATAATGAAATGTTCTCTCTATTGATGCAGTAGTAGATActtacctataaacacgtgtacaacaaatatgttgagtcacacacataaatgaaacattttatagtctaaaattgagccaaataaacttattttaaagaaataattgtaatgccgagactcgaggtgagtctctgtccttgaagtggcccacaaggtatttttctgcaggggccagggagagcgggaactggctgcgccttggactgcggttctggaataggaagggtcagcaagcacgtcttgttgcctgttttcagcagtgttgaattggtggacatgatggaatccttcctccttgaagcccagagctacttgcaggttaacgaggacaaagttgaaagttaccactgctacagcctgcaggagttcacgccccacttagggagatatgatgtcatctggattcagtgggtctcaggtcagtgttgcacctcatagcttccgcccttccccatttcctccttaggaaaggtgacacttgggactttcaacacgttttgctagctcaggctgtcatgtgaactcccaacaactctgggccctgaagttctcttaacattgctgcacaaacttggcaattcttacccctagggataGAGCTGGAGCCTGAAACAGCCTACATCTTTGCAGAAATGTAAATACTTGAAAACATTGGACCCATAAATGGTTAATCCTCATTATTTATTGGTAGAACTAAATGTTCTGAGACTTAAATCCTTAGGAAATGAAACAGCAATGAATTATATTCTCTCTCTCTTCCTCTCCCTCTTCCTTT
This mutation is a 596 bp deletion beginning at Chromosome 1 position 163,703,825 bp and ending after 163,704,420 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46261 | ATA GGA AGG GTC AGC AAG CA | Wild type Forward | A | |||
| 46262 | GTA GCT CTG GGC TTC AAG GA | Wild type Reverse | A | |||
| 46263 | GAA ATG TTC TCT CTA TTG ATG CAG T | Mutant Forward | A | |||
| 46264 | ATG GGT CCA ATG TTT TCA AG | Mutant Reverse | A | |||
| 46265 | Fluorophore-1 | CTT GTT GCC TGT TTT CAG CA | Quencher-1 | WT Probe | ||
| 46266 | Fluorophore-2 | ATA GAG CTG GAG CCT GAA ACA G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46261 | 0.40 uM |
| 46262 | 0.40 uM |
| 46263 | 0.40 uM |
| 46264 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.