For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:100076198+100076342 145bp TGGACATCGACTATGAGGTGA TCTTGACCTTGGTGCAGTTCT
Mut= 143 bp
Wt= 145 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCTTTGGCTAATACTGTAAGTATTTCTGTTACCAGGTGATTGATGGTGTCCTGAAAACATTACATTTCCTGTGTGGAAGTGGGGGTGTATATCATTTGAGCTAGAACCTGGTTCTGGAAACTGAGACGAAAGCCTGTTGCATGACATTTTCCAAATGCTCAGTGGTATgccctgtagagggacagcttgaactgagttagtttgagggaacatcaggttcctggtactcagtgctgcagataattaggattcaaagttgacaggctaagactctattccatcttcccctatgcagatgatagcaaagcccgcctcagtagtattacaccctcagccattctgggtagccttctggatgaccagcactggcactcagttctcctggagcgtgtgggaaagcaagcaaacttcactgtggacaggaacacccagcactttcggaccaacggtgacactgatgccctggacatcgactatgaggtgagacaatcctcccaatatgttccaaggagtgggagggaggttgctatataaaaattttaagccactttatCTTAGCTGGGCTACCAGGGAGAAATCTCTGATGAAGAACTGCACCAAGGTCAAGAAATGTCTGGGCCAAACTCTGTGTTCCTGATGAAGTGTCAATTGTACAAGCTAAAAACCAATACTTCTATTTACTTTCTCTGTGTGTAACTATGTATGTATGTATGTATGTATGTATGTAT
This mutation is a 385 bp deletion beginning at Chromosome 1 position 100,075,903 bp and ending after 100,076,287 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46239 | TGG ACA TCG ACT ATG AGG TGA | Wild type Forward | A | |||
| 46240 | TCT TGA CCT TGG TGC AGT TCT | Common | A | |||
| 46241 | GGG GGT GTA TAT CAT TTG AGC | Mutant Forward | A | |||
| 46242 | Fluorophore-1 | CCT CCC AAT ATG TTC CAA GGA | Quencher-1 | WT Probe | ||
| 46243 | Fluorophore-2 | CTC AGT GGT ATC TTA GCT GGG CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46239 | 0.40 uM |
| 46240 | 0.40 uM |
| 46241 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.