For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:20240714-20240833 120bp CCTTAGACCAACTTCGTTTTCA GGAAAGGGCACTGTGTTGA
Mut= 119 bp
Wt= 120 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGCTTCATTACAGGAGATTTCCGAAATAGGATGAGTCTCGGTACTAAGCACTAGCAGCGGGCACCCTGAAATCCCCTGAACGCTCTGCTCGTCTTCCTTTTCTTAGTATACCAAGCAGTCGGTTTAACCGTAGGATCCTTAGACCAACTTCGTTTTCATTGATAATCTTCCCTATTCCCCCCCCCCCCCCagtcttgtgaagaaaactgttcttagaaacaagaagtctgcttggtttcaacacagtgccctttcccccttgttattgcagatggaggaagacaggcttcctgcctcccaggacctacttccagctcttcaagtctttggaactataactgtttgctcaggacaggaggctgacagtgaagacttccaggctacgcttgatccatctcaggtgttgggcctcagccagcaaccacacacctcaggtctccctctcccgccacagtggaagtccacggtgagcccaggtgctcctcagctttctagcagaagcatctctgcctcctcggtgggcagcagtcttcaggatcaccaagagaaggcaggacctcagagggcctcttttgccaatgtctcctctcccgagttgactgtaccccaggcagcccactctgtggtgggggcagggcctccgctccaggggtcagcacagcctctgacctctggcagtgatgctacaggcctgggtaagagacacctctcctttcaggcagaatactgggcctgtgcgctgccaaattctctgcctccttcccctaaccgccactccgcactctgggacccaaataaagagtatgaagatctgcttgactacacttacccactgaggcctgggcctcagctcccaaagcaacctgaaagtcatgtcctgactgagcctgttctgcaggactcaggtgtagatctggacagtttgtctgtctccccagcaagtactctaaagtcacccactaatgtctcccacaattgctcatcagcagaagtgcctactctgccattttctggagccagagagtcatgtcttaagcgctggcccttgggaatattccagaaacagggtggcacaagcttgtcatcctggaaccagcttgcatcaacccctagagccccaggcactgaagatgcttcttgggagaacagagaggcagccctgaggggcacagcggaggactgcctccctataggtgaggacctccgaatgggctctccccagctgaagacgaaggagaaagagccaccctttcccagacagaagagaggcaggcagcatgttagctgcccggcctgtgtgacgcctggatggccatcagaagaggaggtgggaagtgatgaggagtaccttgctctgcccaccaggctgactcaggtctctagtttggtgtcctactcaggtgccaggccctcctttgtgaacctacacactggggctgctgaggaacacagttcactacaagtctcagacagtgacaagccagcctcccccacattggactccagccacaggaagcatccttctggaacttcctttcaagggcctgtgggccagaacccctgcttcaggcattctatccagccccaggactctagaggcaaaagtagtctgatgagtaaccagaccctcggggtctcttcaaaaccactgaaaactcagcccgcctcaaaagccatgacggacaggcggctgttctccgagctagtagctggagagacacttcccaggacgacagatgagcaggagaaagcttctctagtgcagtgtgtgcaggtaaaaatgttcacggagaatcttctggaaggagtgatgtttccccagcccaccaacagcatgtctcggcaccctcaacatatatgaccccaaattagaggtatcgttctcctttagtgattgcaagaaaatggcagagaaatcaggtaacgcagcagcagtgttccgtgtgctttggtagaggctgatccacagttttactagtttactcactcatcctgcatctgcttttctgcagagaaagtttagtggtcggtaacggcccttgttccttagttccactctcaccttcagggctctgcattctgagcctagttctgatatcacatctggctgaggcacagccagttatggcattcattatcctggcagaggaaaacctggagtcttgggatagaggtggagacaaatgaccatctgaaagaaaactctagaaaatttgtatgccaaaatgctggtaattttagccttcggacaagttaaatagcagctcagtcagatgtgccatgtagacttctcttgttgtactgagccctgaacatgcctgaagtaggcagacttcatcactgagctcagtccagcccaccaattgttcttgtctccacagacattttgctgtcggctggaagagctgatctgctggttgtataatgtcacagatgttgctgacctcagtgctccacccaggaccagccttacaggtctcaagtcttctctgcagctttacagggtaatatgtagtcctggcttgtttatccacggggatgggagttaagtcacttttacaaaataaaatctcaagtaactggagtcttgtagctcagttgactattttatctgataaatcgaattaagatgtccttttcaaattctcagtgttgaacactataaaatgtactaagtgaggtaagaggataattacatacattggagccagaatgctttagaggagtttgcatgggattctggcagatccctcagggctagaatcctgggCTTTGATTTACAGACACTAATCAAGTATGACAATTAGTTAGGGTGAGCACCACAGCTATGCAGTGGCCACCACACCAGGCAGTGCAGACACAGAACGTGCCAGCCTCACCGCAAGTTCTTTTGGACTGTGTTGGTGTTTATGGGGTTGAGCTGAAACTACTGGGATCCAGGCACAGACAAGGTGATGTGAGACTTTGGGTTTTATTTCTGCC
This mutation is a 2580 bp deletion beginning at Chromosome 11 position 20,238,200 bp and ending after 20,240,779 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46234 | CCT TAG ACC AAC TTC GTT TTC A | Common | A | |||
| 46235 | GGA AAG GGC ACT GTG TTG | Wild type Reverse | A | |||
| 46236 | CAC TGC ATA GCT GTG GTG CT | Mutant Reverse | A | |||
| 46237 | Fluorophore-1 | CTT AGA AAC AAG AAG TCT GCT TGG TT | Quencher-1 | WT Probe | ||
| 46238 | Fluorophore-2 | CCC CCC CTT TGA TTT ACA GA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46234 | 0.40 uM |
| 46235 | 0.40 uM |
| 46236 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.