For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:104082614+104082708 95bp TCTAACTCAGAGCCATACAGTGTC CATATGGGGAACTAAATTCAC
Mut= 80 bp
Wt= 95 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGAAGAGAAACAGTTATCAGTACAGATGCTGTGACCTGCAGGTGGCCTTGTTTGGGGCAGTGGCTCATTTTCAAGTTTGGTTTGAGTCATTGGTTATACTTCTGCCTGGATGAGAGTGTCACAACTATGTGATATGAGTGTGACTCTAACTCAGAGCCATACAGTGTCCTCTGCAAGTATGTTCCTGGTCTCcatggtctgactgacgtctggagtccgtgaatttagttccccatatggatcacacactggaaagactaattgggtagccggggatcgttttcaatgaactttaattgtcccatgttaatttacttgtagggagtctatcgtagatacctcatgggaaataactcatctgaggatagcttcttaactgccaatactgtgcaacctctggcagaaactggattgcagctgtcaaaaaggtaagggaagcatattctctgggtaattcaactggcttggtctcctaagaccgcagagtcaggagacagtctgggttcgtccagttaaatagtcactggatgtgagaaggttaaaatgttaagaaaatggaaatgatatctctgcccagacTAGGGCTGCTTTGCCAGTCAGGATAGTTTTCTAGTAAGTCACTATATACCTAAAAAGATATTGACTTAAAAATGAAAAAAAAATTGCCCATATTTATGATTAAGTGTATTCTTTGCCACTTTGAATGTATAACCTTTTAAATACATAGGTGAATATAGTTTCTTATATTTGTTACACATAC
This mutation is a 387 bp deletion beginning at Chromosome 9 position 104,082,662 bp and ending after 104,083,048 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46223 | TCT AAC TCA GAG CCA TAC AGT GTC | Common | A | |||
| 46224 | CAT ATG GGG AAC TAA ATT CAC | Wild type Reverse | A | |||
| 46225 | AGA AAA CTA TCC TGA CTG GCA AAG | Mutant Reverse | A | |||
| 46226 | Fluorophore-1 | ATG GTC TGA CTG ACG TCT GGA | Quencher-1 | WT Probe | ||
| 46227 | Fluorophore-2 | TTC CTG GTC TCT AGG GCT G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46223 | 0.40 uM |
| 46224 | 0.40 uM |
| 46225 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.