For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:181575225-181575324 100bp TGAATAATGAGGCCCTACCC AATTAATGGCAAGATGGCAGGA
Mut= 116 bp
Wt= 100 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CATACATCTTTCTACTGGCATGTGGCCAGTATACTGCACTTTCACCTCCTGGGGCAACCAGGGGTAGGGCAGCGGTGGCTGGACTACCTAAGGAGTGTGCTGTGCTGGGGAGAGAGGCACAGTCCTTAGATCCTCCTTTTTCTTGAATAATGAGGCCCTACCCACCACAGTCcacatgggtaggattgtggctctgagatcatgcatatcctcctgtgtcctcctgccatcttgccattaattgctgtcccttgttcttgctgtgtgaacagcctgagatcttgtgccccagttaaccctatggaacaggtaaaggcaggtttcttggacacactctccccagttgagcctatattgtgcctgtcccactttggtctgaccagagaggttgaaaactgttgactgaggctaagcacattcctctttacagcagcaatgcagggaccttggacagacttctcccaccagtgggtactgggcgctcaccccggaagcgcaccaccagccagtgcaagtcagaaccacccctgcttcgcacaagcaaacgtaccatctacacagctgggcggccaccatggtacaatgaacatggtacacagtccaaggaggcctttgctattggtgagagtggtatgggaaggcaccttggggatctgtctgcatggccagcccagctgcaacagtttgcaaggtaccctttcactccacaggcttaggaggtggcagtgcatctgggaagaccactgtggccagaatgatcattgaggcactagatgtgccctgggtggtcctgttgtccatggactccttctataaggtgaggccctgctcatctacccccagagcatcttctctctgtgactgctttgcctctacaaatgtaggcctgtggtcagcagcaggcttcatcatgcccctccacccccaggttctgacgcagcagcagcaggaacaggctgcctgtaacaatttcaactttgaccaccctgatgcctttgacttcgatctcatcatttccacccttaagaagctaaaacagggcaggagtgtccaagtgcccatctatgatttcactacccatagccggaaaaaggactgggtaggcccatggtgtgggggcctacctatgggagaggttgcaggggtctgagctggacattaaaactctctgggttccttttcagaaaaccctgtatggtgcgaatgtcatcatctttgagggtatcatggcctttgctgataagacactgctggaggtgagagcttgccgggagcacccactccacaggcatccccataaatactctcttagtaatacgccgccccatcctcacagcctctatgatttgagatttctccctattgggcagttctggatgcgccccacctggtgtatcCTAGGCATTTACAGCCGTTCTTTGCCATTAGCTGACTACTACAGTGGGTGTGGCGTCTGCGGACAGTGGTTTCCTCTCCTACCTTCGGGGAGGGAGCTGTACTTCTGTCTCCCTTGCTCTTGATATTTTTCCTTGCTAAAGAACAAACAAGGACTTAAAGCCAGTGAGTTTAAGGGACTTTGC
This mutation is a 1225 bp deletion beginning at Chromosome 2 position 181,574,071 bp and ending after 181,575,295 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46202 | TGA ATA ATG AGG CCC TAC CC | Common | A | |||
| 46203 | AAT TAA TGG CAA GAT GGC AGG A | Wild type Reverse | A | |||
| 46204 | CGA AGG TAG GAG AGG AAA CCA | Mutant Reverse | A | |||
| 46205 | Fluorophore-1 | AGG ATT GTG GCT CTG AGA TCA T | Quencher-1 | WT Probe | ||
| 46206 | Fluorophore-2 | GTC CTA GGC ATT TAC AGC CGT T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46202 | 0.40 uM |
| 46203 | 0.40 uM |
| 46204 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.