For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr19:29026989-29027077 89bp TATCTCCTGCAGCCTGGTG TCCATTTCCTATTCCAACCA
Mut= 89 bp
Wt= 89 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAGACTGGCCCTTAACTAACCCCACTAATGTGTAGCCAAGGCTTTGACCTCTGGGACCTCTTGCCTGCACTTCCTATGTGCTGGGATTACAGGCATGCCATCAACCCAGACTGGAGTTCAGTTTGGTTGGAGATTCTAGTAAGATGGCAGGCAGACCGTCTTCCCTTACTTCTCTACTCAGgcttgagtagagaaccctgggagggcaatgtgctgtctatacagaaatactgtcacatgcactcagaatgtttgcccaaatacctgagtactctacagcccagtcaagtagacaataaatttgatttcagttatattacggctctggtcaacatgcctggtgtcattccttgggctcaatttgcctaacactttttctttcttgcctgcctgtcccctctctcctcctcccctcatataaaggatttccaaggacacttccacaggcagaagccctggataaagtttatcagatagacacagtgataaatctcaacgtgccctttgaggtcattaaacagcgccttactgctcgctggatacatcctgccagtggtcgagtatacaacattgaattcaaccctcccaagactgtggtaagtgactgtagcgagctgagctgacatccactctaacaggcatagctgtgaacttctcatcctatctgaccaagactattgcacgggtcctatctcctgcagcctggtggtaagagacgtccccgtgctaatagGCTTGTTAGTCATTCAGAAGTGCTATGGTTGGAATAGGAAATGGATCCAACAGCTCAGTGTGGTGTCTGCTTAGTCTCCAGATGGTGGCATAATATTTGAGGTCCATCACAACTGGAAAAAGTGTGTCACTGGGACATCTGCAACCTATGAATGATCCTTAGCCCCTTCTCCACTCTGC
This mutation is a 552 bp deletion beginning at Chromosome 19 position 29,027,034 bp and ending after 29,027,585 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46182 | TAT CTC CTG CAG CCT GGT G | Wild type Forward | A | |||
| 46183 | TCC ATT TCC TAT TCC AAC CA | Common | A | |||
| 46184 | AGT AAG ATG GCA GGC AGA CC | Mutant Forward | A | |||
| 46185 | Fluorophore-1 | AGA GAC GTC CCC GTG CTA A | Quencher-1 | WT Probe | ||
| 46186 | Fluorophore-2 | CCC TTA CTT CTC TAC TCA GGC TTG T | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46182 | 0.40 uM |
| 46183 | 0.40 uM |
| 46184 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.