For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr2:143988068-143988162 95bp AAAAAGGAGAGCCTGGTGAG CAAACAGCAGAGCACTAAGGA
Mut= 112 bp
Wt= 95 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case; and insertion with carrots ^g^ (TTAGTGCTTAG insertion):
TGCTTAGCTTTGCTGTCTTTGTCATGTTGCCACTACTCTCTGATGTTTCACTTCCGGACAGCACTTGTGCTCATGAGTGCTTTAAATGGGGCGGGTTCAAGGGGGCACCTTGAACTTGGGCCATGGCCATGGGCTTTGGAGGCTACAGAACATTAAAAACTTGAGTCGTTCCC^ctgtacttctccatccgcctgtttgtatctccagtactaaaagaactattgataccgtaggtaaaaattacccatttctgaagagagggtaagaaagaggagcaaacatggctttgctcctactctgaatttagtctgaagacagtgagaaaccttgagtttggtgataggggatggaaactgtccagtccctcagtttccccagaagtaatctacttgtctgtgttggcaggtggaaagcaagccagccaagatggatatctacgacactcagaccttgggggttgtggtctttggcgggtttatggttgtttctgccatcggcatcttcctggtgtcaaccttctccatgaaggagacgtcgtatgaagaagcccttgccaaccagcgcaaggagatggcgaaaactcaccaccagaaaggagagaagaaaaagaaggagaaaaccgtggagaagaaaggaaagaccaagaaaaaggaagagaaacctaatgggaagatacctgaacatgacctggatcccaacgtgaccatcatcctcaaggaaccagtgcgtgtatccgctgtggctgtggctccaacttcagtccattcttctgtgggccatacccctatagccacagtaccagccatgcctcaggaaaagctggcttcctcccctaaggacagaaagaagaaggagaaaaaagtggcaaaggtggagccagcagtcagttctattgtgaattccatccaggttcttgcttcaaagtctgccatcttggaagccacacccaaggaggtgcctatggtggctgtgcctccagtgggctctaaggccagttctcctgccaccagcagtcagggcaagaagggacagggagcccagaaccaggccaagaagggggagggagcccagaaccaaggcaagaagggagagggggcccagaaccaagctaagaaaggagagggggcccagaaccaggccaagaagggggagggggcccagaaccaaggcaagaagggggagggagcccagaaccaggccaagaagggggaaggaggccagaaccaggccaagaagggggagggggcccagaaccaaggcaagaagggagagggggcccagaaccaaggcaagaagggggagggagcccagaaccaggctaagaagggggagggggctcagaaccaagctaagaagggtgagggggcccagaaccaaggcaagaagggagagggggcccagaaccagtccaagaaaggagagggggctcagaaccaggccaagaagggggaagggggccaaaaccaggccaagaagggagagggggctcagaaccaggccaagaagggggagggagcccagaaccaagctaagaagggggagggggtccagaaccaggccaagaagggggtagaaggggcccaaaatcagggcaaaaagggggaagcaaaccaaaaccaggctaagaagggtgagggaggccagaaccaaaccaagaagggggaaggaccccagaaccaaggcaagaagggagaagcagctcaaaaacaggacaaaaaaatagaaggagcccagaatcaaggcaagaagccagagggaacctcaaaccaaggcaagaagggggagggggcccagaaccaaggcaagaagggagagggggcccagaaccaaggcaagaagggagagggggcccagaaccaaggcaagaagggagagggggcccagaaccaaggcaagaagggagagggggcccagaaccaaggcaagaagggagagggggcccaaaaccaaggcaagaagggagagggggcccagaaccaaggcaagaagggagaggggccccagaaccaggccaagaaaggagagggggcccagaaccagggcaagaaaggagagggggcccagaaccagggcaagaaaggagagggggcccagaaccagggcaaaaaggcagagggggttcaaagtcagagcaagaaaggggaagggacccagaatcagggcaaaaagggggatggaaatcccaaccaaggcaagaagggggagggggcttccaaccagaacagaaagacagatacagttgctaatcagggcacaaagcaagagggtgtctcaaaccaggtgaaaaagtcagaagggtcccctaatcaaggtaaaaaggcagagggagccccaaaccaaggcaaaaagaaagatggatcccccagccaggccaaaaaagtggatgcagctgccaatcagggtaaaaagtcagagatggctcctgcccagggtcaaaaggcaagcatggtccagagccaggaggcaccaaagcaagacgcacctgcaaagaagaagtctggttccaggaaaaaaggagagcctggtgagtgcccgtctgctctgtgagcttgagggaaagccgctgactgtgactga^TGGACTTCCTTAGTGCTCTGCTGTTTGCCATTGTCTTTTCACCCCAGATAGGGTATTGATGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGATAGAGAAATAACTCCACCTAGTCTCTCTTGGACTATTGAGCTTTTGGGATTTTATACAGGAGCA
This mutation is a 2404 bp deletion beginning at Chromosome 2 position 143,988,095 bp and ending after 143,990,498 bp (GRCm38/mm10). In addition, there is an 11 bp insertion at the deletion site (TTAGTGCTTAG).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46160 | AAA AAG GAG AGC CTG GTG AG | Wild type Forward | A | |||
| 46161 | CAA ACA GCA GAG CAC TAA GGA | Common | A | |||
| 46162 | AGG GGG CAC CTT GAA CTT G | Mutant Forward | A | |||
| 46163 | Fluorophore-1 | CGT CTG CTC TGT GAG CTT GA | Quencher-1 | WT Probe | ||
| 46164 | Fluorophore-2 | AAC TTG AGT CGT TCC CTT AGT GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46160 | 0.40 uM |
| 46161 | 0.40 uM |
| 46162 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.