For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:80576732-80576828 97bp AGCCACCGCTGTCCCTTC ATACGAGGGGCTTACCTGTG
Mut= 80 bp
Wt= 97 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case) point mutation in brackets with wt first:
CGGGGCGGGACTGAGCGCGGGCGGCGGCGGCGCGCCGGGGCCTCCTCCTCCCTTCCCTCCTCCGCCTCCCGCACTCTAGCAGCCGCTGCCGGCCGGACGGGCGTAGGTCCCACCGCCTCCGCTTCTCTCCCGCCGCCGATTCCGTGTCTCCG(C/A)GTCCTTGcccggcatgtcggcggccgtggcgtgtgtggattactttgccgccgacgtgctcatggccatctcctcgggagccgtggtgcatcgcggacgacccggccccgagggcgcgggccccgctgccggtctggatgtgcgcgccacgcgccgcgaggccacgccgccggggacccctggggcaccgccaccgccagctacggctccggggccgggaggcgccaccgctgcgccccacctgctggccgccagcatcctggccgatctgagaggcgggccggtagtcgccaccgcagccagcaccgcggggggcacctctccggtctcctcctcctcagccgcttcgtctccctcttcgggccgcgcccccggcgccgccaaaagccaccgctgtcccttccatggctgcgccaaagcctattacaagtcttcgcacctcaagtcacacCTGCGGACTCACACAGGTAAGCCCCTCGTATTTTACACAGGTGGGATGCAGGGAGTGCATTAGAGAGGTCTCGGGGACCCCGTTCCCCCATCTCACTTGGAACCCCGAAACTGCGTGGCGCGTGGGGGGCGGGGAGGGGGGCGCGCCCAGGC
This mutation is a 444 bp deletion beginning at Chromosome 10 position 80,576,763 bp and ending after 80,577,206 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 42662 | AGC CAC CGC TGT CCC TTC | Wild type Forward | A | |||
| 42663 | ATA CGA GGG GCT TAC CTG TG | Common | A | |||
| 42664 | ACC GCC TCC GCT TCT CTC | Mutant Forward | A | |||
| 43625 | Fluorophore-1 | CGC CAA AGC CTA TTA CAA | Quencher-1 | WT Probe | ||
| 46159 | Fluorophore-2 | CCG AGT CCT TGC TGC GGA CT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 42662 | 0.50 uM |
| 42663 | 0.50 uM |
| 42664 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.