For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:111635117-111635238 122bp CCCATTTCAGGTATCCACCA TGATGGGTCCTGTGACTCCT
Mut= 125 bp
Wt= 122 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGTGGGGCCTAAGAAAGCAAGGCTGGGAAGGAAGATGGTGGAATGGGTCATGTGGAGCCTCTCCCTGCTCACTAGCTTATGGGATACAGGATGAACTACTGAGTCCCATTTCAGGTATCCACCAGCCTTGGACTGCCCGCCCTGGGGCCTGGCAGAACTTCCCAGgtatacatggggtctagggcagagctggctgcatcccccacaggagtcacaggacccatcataagagaggctgtcctgtcattgccttgcagctccagaaactaaaacggtcactttctttcaagaccaagagcttgcggagcaaaagtgctgacaacttcttcccaagaaccaacagtgatgtgaaaccgcaagcagacctgctggccaaggccagcccaggccccagcccaatagccatccctggaagcccagcgtccatgcccaccaaggctggcctgcaccccggcagcaacagcaagctccacgcctttcaggagcatgtctttaagaagcccaccttctgtgatgtctgcaaccacatgatcgtgggtaagacccctacccccacccctacaggtacaatgtccttgggaaaaggaatgagagctggaggcccaggttcagGGGACCCATAGACCAGCTCTGAGCTTCAGAGAGTTAAATGTAAGAAGGTCAATGTGGGGAGTGGCCATGATGGAGGGGCCTTACCCAAAGCAAAGGCAAACAGGGCTAGGTGGAGGGAGAATTAGTTTGGAATATGGTTGGAACCAAGACAGCAGCTGGCATCGTCCACCAGAAGCCT
This mutation is a 447 bp deletion beginning at Chromosome 9 position 111,634,731 bp and ending after 111,635,177 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46126 | CCC ATT TCA GGT ATC CAC CA | Common | A | |||
| 46127 | TGA TGG GTC CTG TGA CTC CT | Wild type Reverse | A | |||
| 46128 | CCA CTC CCC ACA TTG ACC T | Mutant Reverse | A | |||
| 46129 | Fluorophore-1 | CAT GGG GTC TAG GGC AGA G | Quencher-1 | WT Probe | ||
| 46130 | Fluorophore-2 | CTT CCC AGG GGA CCC ATA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46126 | 0.40 uM |
| 46127 | 0.40 uM |
| 46128 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.