For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:32863698+32863857 160bp TGGTGAAGATGACGAAGCTC TTGCAGACATACTGCCCTTG
Mut= 160 bp
Wt= 160 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
ACTTTTGAGAATGTGTCTGTTCAGATGGCCAGTGTTTGGCATGCCATGTGAGTGAGACCATCGCATATAGGAATGTGGAAGCCATAAGGCCCATAGAAGGGATTCTTAGTGGCTTCTTTGGACTCAGGATCTATGGTCTGAACTGAAGCATACAAACAAGCTAAAGTAAAATAAGAcgaaggaaggagactgaaactagaagggatatggggctctcccagtaccccaaaagatgcttcagaattccaggtgtttcctggtcatggtgaggctgggaagtatagagagtgccaagaccactgcctctgccccttcagagcatccagacgccaatagcatgtggcttgaccctggcttctgggaatggcctggctgcacaaacccaggctgcggccttcattcacctttccatcctcttccattgcagaagtctgtggtgctctcaatgtcacggtgtccccaggacctgtggtggactacttggaaggggaaaatgccaccctcctctgccacgtctcccagaagagacggaaggacagcttgctggccgtgcgctggttcttcgcccctgacggctcccaggaggccttgatggtgaagatgacgaagctccggataattcagtactatgggaacttcagccggactgccaaccagcagaggctacgcctgctcgaggagcgtcgaggggtgctgtacaggctgtctgtcctgacgctccggcccacagatcaagggcagtatgtctgcaaagtgcaagaaatcagcaagcaccgcaacaagtggacagcctggtccaatggctcctcggcgacggaaatgagaggtgagaacgctgttggcatctcggaggaggcgcagtgtgtggtagaaggtggtcctggcgttagtcagtatgtaaatgctggtcgcctcattggctctgctagtatagttagtccacgtcttgtggcctctgtgggccaaatgcctgtgagtcaagttatgaggatgaggacagctcttggacactggctgatgtggaaggtagatatggaggcagggacaacagagtgagtgactacctccgtattagtCATGTCCTGCCTGAAATATTGAACTTTGTATGCTGTCAGATAAAGAAATCTAGCCCCTACTTACTTTGGACAGAGGCGTGTGAGGGTATGGCCTGAGCTGTGCTTACTGTGGACTTGGACTGGGACTTTGTGGTTC
This mutation is a 900 bp deletion beginning at Chromosome 14 position 32,863,282 bp and ending after 32,864,181 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46085 | TGG TGA AGA TGA CGA AGC TC | Wild type Forward | A | |||
| 46086 | TTG CAG ACA TAC TGC CCT TG | Wild type Reverse | A | |||
| 46087 | ATG CCA TGT GAG TGA GAC CA | Mutant Forward | A | |||
| 46088 | GTT CAA TAT TTC AGG CAG GAC A | Mutant Reverse | A | |||
| 46089 | Fluorophore-1 | CAG TAC TAT GGG AAC TTC AGC CG | Quencher-1 | WT Probe | ||
| 46090 | Fluorophore-2 | TGG AAG CCA TAA GGC CCA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46085 | 0.40 uM |
| 46086 | 0.40 uM |
| 46087 | 0.40 uM |
| 46088 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.