For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:84730298+84730444 147bp AGAACACGCTAGGCTTGGAG GATCTGGAAGCAGGCTGAAG
Mut= 150 bp
Wt= 147 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CTGTTCTGTGCAGATGCAATATTTAATCAATGTTTCCACTAGGCGTTGGCTGGGGAACTCACAGAACAAGGCAATCACCTGAACCCGCCTCCCGGGTGGCCTCCAACACTCTCATGGGCATTTTCTCTCCTCAGCTAATTACAAAGTCCTTTGCCCCCTATTCCTGCCCTgcagtgaccctctgttccttttgttccagtgccaggactatcgccgtggctggctcacgggcgccctgtgcgaggacctgtgtgtgggcggggagctgctgtaccaacgctgcctgtattacgagcgtggtaagaaggtgctgcaggctcagtggcgtggccggaccgttgtcctcaaatccaagagggaggccttctccagcttcccgcccctcactctgctggaggaggaagcaggggcaggtgcccccggcatccctgaggctgagctgctcctgatggtggccggggaggtcaagaacacgctaggcttggagctgcccaacaacagcatagccccgctatggcctgccaggcagggccctggctggcggcaacagctggccagtgcgtggtcactgctccaacaggaggaatacgtatacttcagcctgcttccagatctgagccgccacatcctaccggtgctgggatcctgcggtcacttttatgcagtggagtacttggctgctggtagccctcaccacaaggctctcttcccactggatgatgctggccaagcacaggctattagccacattgccctcagcttcctggacatggtgagccatttcgacagtgacttttcccaccggctccacctctgtgatgtcaaacctgagaacttcgccatcaagagggactttacggtgagtggaagcaggctgccatgtttgtggtaagagaagagattctggtctgtgtaggaggaagtgaattcttggcctctggaaggaagcccatgcaactttgggcagccttgtggttcctggtgattcccgttccagaccacttccttgccaggttgacaaaagggtttaagaaaatgcatctccaacctcaagaggagaggtccagtccagtgaagaagcccacaggaggcagagacaggcagggggcggaggagacatctcacttccttgaggGCAGCTATGAGGTCTAGTTAGTGCTGCTACAGGATCTGTGGTCTTCTGAGGACAGTCTTCCTGGGCTGCAGATGGTGTGCTGTTCTTCCAGGCCAGGCATTCTGTGTCCACAGAACCAGTGTGCAGAGAACAGTCATTGCCAGCCGACATTACTCTTCTGGAGAGATTCT
This mutation is a 965 bp deletion beginning at Chromosome 18 position 84,730,001 bp and ending after 84,730,965 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 46077 | AGA ACA CGC TAG GCT TGG AG | Wild type Forward | A | |||
| 46078 | GAT CTG GAA GCA GGC TGA AG | Wild type Reverse | A | |||
| 46079 | ACA AGG CAA TCA CCT GAA CC | Mutant Forward | A | |||
| 46080 | AAG ACC ACA GAT CCT GTA GCA | Mutant Reverse | A | |||
| 46081 | Fluorophore-1 | CTG GCT GGC GGC AAC | Quencher-1 | WT Probe | ||
| 46082 | Fluorophore-2 | AGT CCT TTG CCC CCT ATT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 46077 | 0.40 uM |
| 46078 | 0.40 uM |
| 46079 | 0.40 uM |
| 46080 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.