For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr17:24059509-24059603 95bp CGGTATCCTTCCTCCGTGT TTCTCAGCACTCAGCATAGGAC
Mutant= 95 bp
Wild Type = 92 bp
Sequence
TGCAGTGTCTGTGGCTGAGACACTTGCTGGAGAGTATGGCTTCCACACTGTGCTGGCATCTTCCAGTTCTCAACAGAAAGAGCCAGTAGCACAAACAGGCACCTTCCAAGCTGCAGAAAAAAATGTGTCAGTTATCTCCCAGTATCTGTGGGCTGAGACCCGGTATCCTTCCTCCGTGTGTCACCTGTAGtgaccgtccgtaagtatgtctagtgaactgcctggcattttcagtcctatgctgagtgctgagaactgaaaggtctgtgaggatgttaggttaagcctgacacaagaacctcaggttagaggcagggtgtggggactaggggcgtacctgctttggtctgatctagaagaagctcaggttagagacagggtgtggggatcagggacgtatctgctttggtctgatctagaagaagtcactttttttaacctctatttcaggagtgttggaagaagcagaattttacaatatcacctcactaataaaacttgtaaaggacaaaattagagaacgagacagcaaaatatcccaggtgagatgggtgactaatctgcctgtagcttctgggcttgctgtataagcaggtgtggcttctctgtgtgtgaccttggaccagaactgtcctatccccatcctggagccccaggccttgctcccttcctcatctgccatgtctgccatgaagggccatcagtggagataggcagttctgtggaagttgtgtgatgagtgcacagaggagaaggaggcctgctggggagagTGAAGATGCTGGAGAGCAGAGGCTCTGATGGGAGAATATCAAGACCTGATCTGCCAGTGCAAAGGCCCATGGCCAGCACAGCAGAGAGGAGAGCATCGAGGAGCTGGGAAGTAGGTGGCACAGATACTGGGCATCTGTGCAGTCACTGGGAGGAGGTGGGCTTCCCGGGACCTCTGCTGCCCAGCATGTGTGTGTGTTGTGAGTGC
A 583 bp deletion beginning at Chromosome 17 position 24,058,991 bp and ending after 24,059,573 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45965 | CGG TAT CCT TCC TCC GTG T | Common | A | |||
| 45966 | TTC TCA GCA CTC AGC ATA GGA C | Wild type Reverse | A | |||
| 45967 | TTG CAC TGG CAG ATC AGG T | Mutant Reverse | A | |||
| 45968 | Fluorophore-1 | ACC GTC CGT AAG TAT GTC TAG TGA AC | Quencher-1 | WT Probe | ||
| 45969 | Fluorophore-2 | CCT GTA GTG AAG ATG CTG GAG AG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45965 | 0.40 uM |
| 45966 | 0.40 uM |
| 45967 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.