For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr4:59689918+59690010 93bp GCAAGAAAAGAAGCTAACAGCA CACTGCATAGGAACAGGGATG
Mut= 111 bp
Wt= 93 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGAGCAAGTGAGCCTCCTCTCATGATGGGAAGAGAGTACACCATGAGGAAACGTGCCCCCACTCACTGCCCTGCTTTTCTCTCTTCATTGTTTCTTTATTTGCAGTTGTTGTTGTAGCAAGAAAAGAAGCTAACAGCATTCTCTTGAAACTCTTATcctgtgtggacagtcggctgtcttaccttttccatccctgttcctatgcagtgataatatctacatgcagcttacaagcacatttccttttttattccaaatgattatagttggaaaaaaaaatggactgtgatgtgggaatgtcttgggtaataacagtttcttgttttgattatttccttttaggagagacactgctgatcctgtaacatggaggattgtcttcatacctcatctgagaatctgtccaaattggtcagctgggcccacagccatgggaccatttgcagcctcattccaaacctgaaacacttgctttctgaaggttcccatgggaacctgactgcaatgtggggctgtagtgccggccatgcgtaccactggccactaacagctacttgcagagctgggtcccaagagagggtttgtttccaggacaaccgaagttttaattctgatagtcccagtataattggggtgccttctgagacacagactagccctgtggaaaggtaccctgggagacctgtgaaggcaaagctggactgtaatcggaccagagactcttgtgacttctcttactgcagtgagccctctgaactggatgaagctgtcgaggagtatgaagatgaaaacacactgtttgacatggtttgcgagtcttctgttacagatgaggacagtgactttgaaccccaaacccagagacctcaaagcattgctcgcaaaaggccaggaatcgtcccatcttccatccattcaagttcccagggacagatggtcgatgaatgcagtaatgatgtcatcatcaagaaaatcaagcaagagattccagaagattattacattgtggcaaatgcagagctgactggaggagtggatggaccagccctttcattgacacagatggcaaaacccaaaccccagactcatgctggtccctcctgtgtagggtctgctaaactgattccccatgtaacatctgccatcaacacggaattagacccacacattctgtcagcctctccctctgttatctccagaccgatcatcccaaagactgctagggtatctctggcttcaccaaacagaggaccccctggtgcccatggcactgcccaccaggtgaccatgcagatgcctgtgagcacatcacatcctaacaaacagatcagtatccctttgtctgctctgcagttgcctggacaggatgagcaagttgcttcggaggagttcctgccccacttgcctagccaggtctcatcatgtgaggtagccctttctccctctgttaacacagagcctgaagtgagctccagtcaacagcagccccctgctgctccaaccataaccactgaagccaccgcgcagtgcattccaggtatggaactcgaggtgactgtaagtccctcatccgcgcgtacctaagaatTCTGCGCCGTCAGCTCTTGTAAGACAGTTGGTTTCGTTTGCTAGGATGCAGTCATTTTCATTCTCAGGAAGGTAGAAATAATGAAATAAATTACATGTAAGGAATACTATGAAGGGATGCCATCTGAAGGAGGCTGTCCATTCACCAGATGCACCTTAGAGATGGCAAATA
This mutation is a 1432 bp deletion beginning at Chromosome 4 position 59,689,958 bp and ending after 59,691,389 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45715 | GCA AGA AAA GAA GCT AAC AGC A | Common | A | |||
| 45717 | CAC TGC ATA GGA ACA GGG ATG | Wild type Reverse | A | |||
| 45718 | CTT CCT GAG AAT GAA AAT GAC TGC | Mutant Reverse | A | |||
| 45719 | Fluorophore-1 | TGT GGA CAG TCG GCT GTC T | Quencher-1 | WT Probe | ||
| 45720 | Fluorophore-2 | TTA TTC TGC GCC GTC AGC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45715 | 0.40 uM |
| 45717 | 0.40 uM |
| 45718 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.