For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:44708500+44708641 142bp AAAGGTTCAGGAAACTAGACTG TCAGGCGTATGCATCCATGT
Mut= 140 bp
Wt= 142 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CCTTTTAGATTATGCAAACCCTGTTGCCAAAGTTATCATAACTATAGAAGAACAAAATATTTTCTTATCTGTCAATTATTAAATATATCTTGGCATCTATAAAAGCAGTAAACACAAAATAAAAGTTGTCTTAATTTGCGTAACTGTTATTACTCATAGCTCCCTGCTGATCTTATGAGgtgaggaccaggcgaagtgatatatgtgtaaaagtacagcaagtttggccttagccttggctccatactggtattgcacaaaattaacagatgtattttgtggttaaaaaaaaaagaataaatgccttgatcatttccagttacaatatttctttctttaactaacaaaggttcaggaaactagactgtgctccccagcaagacttccttcaggtgagaatgtatgtatatgtcatcatagaaatttgtggtttaattcagtactgcattttctctgttacagacaaaacatggatgcatacgcctgaagctttatcaaaacattacattccctataatgcaaaggtaaaatggttattgagatattatctatttttacattgttatatgttatgttgaaataattgtgctaattaaaaaaaaaacttatgcattggcatgtcctgGTAAGCAATATTTGAAACTAATTTCATATTACTGAAATAAGTAATATAACATAAAAAATTGTTTTTATATCCAAATTTCTTTGAAAAGAAAGGGATACTCTGTTTAGATTCTCTATAGTCATGTATTTCACTGAAGCTTTAAAAAAAA
This mutation is a 446 bp deletion beginning at Chromosome 1 position 44,708,334 bp and ending after 44,708,779 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45638 | AAA GGT TCA GGA AAC TAG ACT G | Wild type Forward | A | |||
| 45639 | TCA GGC GTA TGC ATC CAT GT | Wild type Reverse | A | |||
| 45640 | TCA TAG CTC CCT GCT GAT CT | Mutant Forward | A | |||
| 45641 | AGA GAA TCT AAA CAG AGT ATC CCT TTC | Mutant Reverse | A | |||
| 45642 | Fluorophore-1 | CAA GAC TTC CTT CAG GTG AGA AT | Quencher-1 | WT Probe | ||
| 45643 | Fluorophore-2 | ATG AGG TAA GCA ATA TTT GAA ACT AAT TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45638 | 0.40 uM |
| 45639 | 0.40 uM |
| 45640 | 0.40 uM |
| 45641 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.