For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:19474494+19474610 117bp TTGCACTGGCACAATCATGT GCTACATGAAACCCAATCCCTA
Mut= 123 bp
Wt= 117 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGCACGTATATGTGGAGGCCAGAGGAAACCTTGCCCGAATCAGTTCTACCATGTGGGCCCTGGGAATGGGGAAGAAACTCGTTAAACTTGGATGGTCGTTAAACTTGACAGCATGCACGTTTGTCCACTCCATCTCATTTGCCTGTTTGTTTGTTGTGACTTGTCCTCAACTCTGTAGCCCACTctcatgagtgcaattgctgaggtcaaaggcaagcgtcaccctcactctcatgttggggggaactcattttgggtggcaagccctgactctctcctcatcccccgcttctcactttgcgggtactgggtatgtgccccgcttcctgacaccttttctctccccaccctgcacagtgctggagatcctgggcctgatccagaggcgcgagctggcgcgagcggacgagcacatcctggagctggaggcggaggcgccgacggcggaggccgaggcgggcgcggggcggcgcgcgcgggacgtggcgctgctgtacgaggcgctgcagcgcgagctctgggcgctggtgcgcgagtcgctggcttccccgggacccggcaccggcgcggtgtcgcagctgggcctcgtgctgctgcaggaggaggcggcggacgcgcgccgcggccccggggcggcccgcaagctgcgcacgcactgggccgaggcggtggcgcgcgcagcgcgcgaacgtctggaggaggcggcggcgccgggcgcgcgcggggcgctggctgggcagctggaggcgctgcgcgcgcgcctgttggaggacgtggccgctgtgcgcggacgcctggcgcccgcctaccctgcggggctgcgcgccggcgccgtctacctgcgtggctaccacgaggcactggccgagtggctcggggcggccgcgcgccgcaggctcccgctggcggatcgttatgcgctgttgcactggcacaatcatgtgtaccccaggtgagcccgggtcgccccggGACGCGCTCACCTTAACCCCAGGCACCTTGTTCAAGATACTGGATTTAGGGATTGGGTTTCATGTAGCCCAGGTTGACTTGAGGTTTTCTGAGACAGGGTCTTGCTCTGTAGACTAGGCTTGCCCTAAACTCAGAGATCCGCTCGCTTTTACCTCTTGAGAGCTCCTATAAAAGCGAGCACCGCTGCACCC
This mutation is a 788 bp deletion beginning at Chromosome 7 position 19,473,755 bp and ending after 19,474,542 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45591 | TTG CAC TGG CAC AAT CAT GT | Wild type Forward | A | |||
| 45592 | GCT ACA TGA AAC CCA ATC CCT A | Common | A | |||
| 45593 | CCA TCT CAT TTG CCT GTT TG | Mutant Forward | A | |||
| 45594 | Fluorophore-1 | CAG GTG AGC CCG GGT C | Quencher-1 | WT Probe | ||
| 45595 | Fluorophore-2 | TAG CCC ACT GAC GCG C | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 45591 | 0.50 uM |
| 45592 | 0.50 uM |
| 45593 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.