For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr14:21686322-21686410 89bp CTCATATTCCCTCCCCAGGA ACCAGGTTTGAGAATCACTTTC
Mut= 95 bp
Wt= 89 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAACCCATTAATGTTTGGAAGCTACAGAACAGGGGCCTCTTTTAAAGGTTCTCCCAGGGGCTCTGTGAAGCAGGCTCAGAGGAACAGATTGTGTTTCAGTTGCCTTTGGGGAGATCTGACAGGTCCACCTCCAGGACCTGCAGCGTAAGGTGAATGATCcaaagggaaagggcaaatgcccagactgcgcctacccagggctgggcagatggtagctttcttatagtcatgaaaccaaacggtgcccagtggcctggggctcgggaagagcgctgctttgggtctttgcctgtaatctccctgcgattactgggtccagcgttgaaagccgtgcaccacccaaagcgcggcgtccaccaaccgaccgacccttctccctgcgcccagggccacggcgctggaccgctatgggctgcagaaggcgggtttcacgcacgtgctgaacgcggcgcacggccgctggaatgtggacaccgggccggactactaccgagacatggccatcgagtaccacggcgtcgaggccgacgacgtgcccaccttcgacctcagcatctttttctactccgctgcggccttcatcgactcggcactccgagatgaccacagtaagtgaccctctccaactctgccctgacaaggccccgcccccaggctgaaaacccacccatcaggtcccgctcccagacataaaacacgccccccctccccgccagccgaggcaccacccctcccgcccacagtgtgctttccccctgctaggtcatgccccaaggcatgctatcctctcccctctggggagaggtcctgccctcatattccctccccaggatcttccaacccggccctgccccagtggatcAGAAGCAGGATCTACAAGAAAGTGATTCTCAAACCTGGTGTACCGGGGCTGAGGATTGAAGGCAGGGATTGGCTGAGCTAACTGCCTGGCCATGTGTGTTGCTGGTGGGGTTCGGGCTTGATATACAGTGTTGAGATAGGAAAGGGGGAG
This mutation is a 703 bp deletion beginning at Chromosome 14 position 21,686,361 bp and ending after 21,687,063 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45420 | CTC ATA TTC CCT CCC CAG GA | Wild type Forward | A | |||
| 45421 | ACC AGG TTT GAG AAT CAC TTT C | Common | A | |||
| 45422 | CTT TGG GGA GAT CTG ACA GG | Mutant Forward | A | |||
| 45423 | Fluorophore-1 | CTT CCA ACC CGG CCC | Quencher-1 | WT Probe | ||
| 45424 | Fluorophore-2 | CCA GGA CCT GCA GCG TAA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45420 | 0.40 uM |
| 45421 | 0.40 uM |
| 45422 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.