For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:109092669+109092776 108bp CTCTGCTTGTTGGGCCTTC TCTCTTCCTTTCAGCACCAGA
Mut= 105 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GCTGCTTATTTTCCTATAGACGTGCTCTGCATGACTGCCCGGGGGAAAGAGCACATGGCTACCACACACACACACACACACACACACACACACACACACACACACACCGCTCTGCTCCCACACCAACAGGTATATTCTGTCTTCATGCAGCAGGTGTTTGTAGAGCCTgtggcaggggagtgtcctctgcccccgtggctgtagtcacaaggctccttgccgatgatggtctgataccactttgttcccacaggaagagaagaggctccgaatagcatacctgcgtgcagaagactcagagcgagagaagttctctctcttctctgcagctgtgcgggagagtcatgagaaagagcgtacaagggctgagaggaccaagaactggtcccttattgggtcagttctaggagctctgataggtgtggccggttccacctatgttaaccgcgtccggctacaggagctgaaggccttactcctggaagcacagaaaggtcctgcgagtctccaggaggccatccgtgaacaggcttctagctattccctccaacagaaagacctccaggaccttatgatggatctgaggggcctggtgcacgccgagcagggccagggctccgggtcaccaacaggttcttctaccagaggaaaagacatagatggcctttcagccaccatgaaagagcagctccgtcattccaggcaggtctattcctgcctagagggtttacgagagcagcttgatggcctggaaaagacttgcagtcaaatggctggggtgcttcagctggcacaggctccagcacatccaggcacggtggggccggtggatggggccctgcccagctccttgctggaacacgggagtgtgatcttggccctgtcagagatggagcagaggctagaagcccaggctaacaggaacactgtctctagcacactggtcacctgtgtgaccttcctggccacattgcctctgctctacatgctgttcaagaccagttaaccctggggaccttcttcaaagggaccgaagggtgactgtcgcttttgttggtgatataatgaatcttgaggtacacacaacctcagcctgactctgaatgccatctgaggggctcaccatctgagatatattttattttgtaggtagtacctatttacattaattatcgaagttttgtgcaaatgtccaattaaaatatctaagaatttgtattatttaaaaggtagttatatcagactcagttttatcattgatttcagaagtctgggacttgaagtttagcctggagtgggggctcaccccctttagttcctttctcatctcctagtggtcctagctcaggactatgttggatgaagttagccctggattctcacttagaatgtcctgacactgttgccctctgcttgttgggccttcctgtgtgtgggctcaatcgagtagagcctcacctggtgcGTGGCTTGGGGAAGAAGAAGCGATGCCGTTCTGGTGCTGAAAGGAAGAGACTGGGGTCATCATTACAGATCCGTGCTGGTCTGCATATCCCTGATACAGAGTCCTGTCCATGCAACCTGGGACCCTCAAAACGGCACAGGCATAGTCCAGGCCCTCGCTGGCAGCAGTG
This mutation is a 1297 bp deletion beginning at Chromosome 9 position 109,091,430 bp and ending after 109,092,726 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45352 | CTC TGC TTG TTG GGC CTT C | Wild type Forward | A | |||
| 45353 | TCT CTT CCT TTC AGC ACC AGA | Common | A | |||
| 45354 | GCT CCC ACA CCA ACA GGT AT | Mutant Forward | A | |||
| 45355 | Fluorophore-1 | CTC AAT CGA GTA GAG CCT CAC C | Quencher-1 | WT Probe | ||
| 45356 | Fluorophore-2 | TGT AGA GCC TGT GGC TTG G | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45352 | 0.40 uM |
| 45353 | 0.40 uM |
| 45354 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.