For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr10:85995611-85995752 142bp GGGGAAACGTCTCTTAGAAGC AACATCCCTGGGCTTGTGAC
Mut= 148 bp
Wt= 142 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
CAAGACGTGCCTTGCGATTATTGTAGCATCCTTTAAAGGCAATTTTTCATCGTTTCCATCACAACATTGGACATGTAATGAAAACTTCTCACAGTAGCCCTGTGGTCTCAGGCAAGCTTCTGTGCctctcttaagactggagtttccgtatgtgaagccaagactacacctcttttgtggggagggggcatgctgcttcctcctctaacatctggtctttctcaatgctgtgtctgtagggttaaagatactgtgtcaccaccatcttccttatgatcaacaaacacttcttgcatccctcacaggtcttcaagttgggatgaaggtactggagcaattggcaaaggaaatcgtcatcccagatttgaacggttctgagtctcttaaatttctgaagattgactatgtaaagtacaacttctcaaagtaagagagtggagcatgttgacttatatcgttaggggctcaaaaccagtggagaaatctatggcagccctaacttagttatctttttttttttttctgtttcatctaagtcctgacttctattcacaagtttgcctcatagctcaatatatctaatactgtgtcgaccacctgatgcatatgtagctgaaaggggaaacgtctcttagaagctcagttcatttaagctaatttaacctcagccacattaattttctcatcTTTGAGGTCTTGTATGGGGCTCTAAGCTAAGCACATTTCATCTATACAACTTAGTCACAAGCCCAGGGATGTTTGGGGAAGGGGAAATGGACATTTTAATGGTAACAAGAATCCAATAAGATTACAAA
This mutation is a 562 bp deletion beginning at Chromosome 10 position 85,995,684 bp and ending after 85,996,245 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45252 | GGG GAA ACG TCT CTT AGA AGC | Wild type Forward | A | |||
| 45253 | AAC ATC CCT GGG CTT GTG AC | Common | A | |||
| 45254 | CGT TTC CAT CAC AAC ATT GG | Mutant Forward | A | |||
| 45255 | Fluorophore-1 | AAG CTA ATT TAA CCT CAG CCA CAT T | Quencher-1 | WT Probe | ||
| 45256 | Fluorophore-2 | AAG CTT CTG TGC TTT GAG GTC TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45252 | 0.40 uM |
| 45253 | 0.40 uM |
| 45254 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.