For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr1:33878456-33878568 113bp TGCGTTATAGCAGCTGTGTGT CAGACAACAAAAGACACTTTGC
Mut= 114 bp
Wt= 113 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TAGAAAGTCAGATTCCTGTCTTCTATTTGAAAAGGGAACATGAACCTTTTCGTGTGTCCTGTCCTGAGTTCTGGAGGGTGGAGAACAAAGCTGGGACTATGCGTTATAGCAGCTGTGTGTGGAGGCAGACATGCCGAGGTctgataagaggcattggcatacagaacatgaggtagctgttgaaggaactgcaaagtgtcttttgttgtctgttgtgttttatattttagagagacccatattcaggaaatgctttcctgcctggggagagttccagcgatgaggaaactcccttaatggaactgtccaaggaggaactttgtaacaaaatcgaaagcctgaaagaaaaactaagaagcatccggaaggaaaacagccggcttcgacagtctttggtcatgctgcaaggtaaaacctcaaaaggattggcattttagataaaagggacaaaatgtctaaaatatggtacaactgcagatcaacagttaaaaatggaaaagaaaatcagttcccaagagagctcaaaattacacttcagaaattagtggatagctaaatttaaatatggacatatccggttattgcagagataatttagattgtcttgcaatgtcccaaatattgtattcacttagtagtattcaacagattgctgaagtgaacttaagctacttacatgctgggcctcaGAGGGGGAAAATGAGTAAGGTCAAATAAACACGCTGTGGTTTCCAGATACACTCATCCCACCCTTCCTACCAGGACAGTTCTAGAAAGTGGGAACCGTGTGATCTGCCGAGCCACTGGGGTTACTGGCTCCACAGGCTGCACA
This mutation is a 549 bp deletion beginning at Chromosome 1 position 33,877,979 bp and ending after 33,878,527 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45242 | TGC GTT ATA GCA GCT GTG TGT | Common | A | |||
| 45243 | CAG ACA ACA AAA GAC ACT TTG C | Wild type Reverse | A | |||
| 45244 | CTG GTA GGA AGG GTG GGA TG | Mutant Reverse | A | |||
| 45245 | Fluorophore-1 | AAG AGG CAT TGG CAT ACA GAA C | Quencher-1 | WT Probe | ||
| 45246 | Fluorophore-2 | ACA CGC TGT GGT TTC CAG AT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45242 | 0.40 uM |
| 45243 | 0.40 uM |
| 45244 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.