For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:43966735+43966814 80bp AGATTCTTTGAGGTCACTGGTAGC ATCTGATAGAAAAGGTATGGAGGGAGA
Mutant= 125 bp
Wild Type = 80 bp
Sequence
GTTGTTGTTGTTATATCTGCTGTCACCATAACAAGAAAATTAAATGAAACTATTTTACTTATTGAGTTTTTATAACATGTCAAAGATTCTTTGAGGTCACTGGTAGCATCCATGAaagatcatcaaggatcctttgtctccctccataccttttctatcagattaatgctttttaggtgattaattaattaattaaattaattaattaatttagattaatgcttcctgtttctaacagacaagccagagttattattttttgtgttattgaactgaccaaatagcttctttttctattaaacaaagttgtttgcagtgtttcgatgatataactatatttctttcaggacccatgcatgaaatttcaagcacagatgaaaaatggtacactgacgtgtcccaaaggcaacaattcttctcaaagtctcaatgacatcattttccaaagtgaatgcatcttgtgcaaaagagcactgtgagtaaattccatttccttccacatgttcaaatcaccaactgcctcgtctCTGGAGCATTGGGAACATGGGGGTTTGGGTTTTTTTTTAAATTTTTTATTAGATATTTTCTTTATTTACATTTCAAATGCTATCCCTGTCCTGATTTCCCCTATGAAAACCCCCTCT
A 412 bp deletion beginning at Chromosome 18 position 43,966,767 bp and ending after 43,967,178 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45132 | AGA TTC TTT GAG GTC ACT GGT AGC | Common | A | |||
| 45133 | ATC TGA TAG AAA AGG TAT GGA GGG AGA | Wild type Reverse | A | |||
| 45134 | CAG GAC AGG GAT AGC ATT TGA | Mutant Reverse | A | |||
| 45136 | Fluorophore-1 | TGG AGC ATT GGG AAC ATG G | Quencher-1 | MUT Probe | ||
| 45138 | Fluorophore-2 | CAT GAA AGA TCA TCA AGG ATC CTT | Quencher-2 | WT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 45132 | 0.40 uM |
| 45133 | 0.40 uM |
| 45134 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.