For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr9:44317095-44317186 92bp TAGAAGTGGGGAAGGGCAGA CAGCAGAGAGCTGGCAATG
Mutant= 96 bp
Wild Type = 92 bp
Sequence
TCTAGGGAGAGAAGAGTTTTTGTCTTTGTTTTGAGACAGGATTTTACTGTGTAGGTCTGCCTGTCCTGGAACTCACTCTGTAGACCAGGAAATCTGCCTGCCTCTGCCTCCAGAGTACTGGGATTAAAGGCGTGCGCCACCACCACCTGGCTGAGATTTTTGCTTTTGTCTAATTCATTGAGAAGCTTAGGGCCCCCAAAAGGACATCATCCCAAGGATGATAGAAGTGGGGAAGGGCAGAGCCAGGTGGGTGTCCTCcgcagtgcctgacactgttccctgtttcaggtgctgcattgccagctctctgctgaggaggtgcgcttccccatctctgtgacccagcagtcccccgctgccgtctccatggagacctaccacgtcactctgacactgccaccaacacaggtggagggaaatgggggaaactgagttgggcagagggcagttgagttggcccagcattttctccctgcttcctctctaccgttggattcgggaaggaagggtccgagtagttagcagggtggggggatggggtcctgaagaatggggtagatcacagtaatccttccgttcttgtctctagttggaagtcagcctggaggaaatccctgatgaggggctcctggtgtcctgggccttcactgaccgcccagaactcagcctaaaggtgcttcccaagttgcagactagggaggtaagaagggggcagcagaggagagactgaactggcgcaatggagcagggcggaggctccacctcttctcctctctgcagagagatgaggaacaaccagagctctcaacagttgaggaactgatcaaggacgctatagtcagcactcagcccgccatgatggtcaacctcagggcctgctctgccccaggaggcctggtgagtggacacccaaagggaaggtttgcgtgtatcccacctccaggttactatatcgggattatttctctttttactcccttttgctcttaggtacccagtgagaagccacccacgatgtcccaggcccagccatccatccccagacctacccgattattcttacggcagcttcgagcatctcacctgggaagtgagctaggaggtgagaattccgctgcccaggacatagcttctctattccgcggacttggtttcttccgtctgagcatcctctaagctctgcttcctgacaggtactgaggaactgtgctgtgccgctgagcttgacaaccccatgcaacaaaagtggaccaaacccatgagggcgggccccgaggtggaatggaccgaggacctagctctgtaagtcacactctgctcctcccctctgtccccatgggcagtcaggatgaagaaacttttccaggctagccctggcatgaggaagccagccttgttttcagtagcctgtagtgtggacctccactgtatgccaggccctggggacacagactaggagtagatacagccctacctctgggtggatcacagacccgaagcagagacacatagggaagaaaggacaaagttgccagttgagattggtgcacagcatgcCGTGGAGGCGCTTCAGTAGGGGAGATGACGAATTCTCAAAACGGACTAAAGAACTGATGAAATGTCATGGAAGAAGTCTATTTAAACCACGCCTTCAAGCAAGGGTAGCACCGCAACAGAATGTGAAAGTCTTCTT
A 1299 bp deletion beginning at Chromosome 9 position 44,315,851 bp and ending after 44,317,149 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 45127 | TAG AAG TGG GGA AGG GCA GA | Common | A | |||
| 45128 | CAG CAG AGA GCT GGC AAT G | Wild type Reverse | A | |||
| 45129 | CAT CAG TTC TTT AGT CCG TTT TGA G | Mutant Reverse | A | |||
| 45130 | Fluorophore-1 | AGT GCC TGA CAC TGT TCC CT | Quencher-1 | WT Probe | ||
| 45131 | Fluorophore-2 | TGG AGG CGC TTC AGT AGG | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 45127 | 0.50 uM |
| 45128 | 0.50 uM |
| 45129 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.