For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr8:84159153+84159265 113bp TCATGCCTGTATTTTGGAAGC CCCATTTCCTTATGTGGCTATAC
Mut= 100 bp
Wt= 113 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TTCTTGTTGAATTCCAGGGCCCAGTGAGAATCCTTGTCTCAAACAATAAGCTGAATGACCCCCTAAATATACTAATATGTTCACACAAAGTTCTTGAATCAGCCTCCAAAATGCAGGTCACCTGCTCATGCCTGTATTTTGGAAGCTGATGGCGGCAGGAAGTTCATAgccacagggtaagatcccatctcaatgaaaaagaaaaaaatctaattgtatagccacataaggaaatgggccctgcatcttgaaatgggctccttctcatcttcccatcactaggtgagcatcagtactggccgccttgccttcatcaaagacccactcacctagtccagctgtggtcctgttgtgctaagctaccagctatactaaacctgactacatccctgccccttacttccctctctaaatcaggggtcggcctccatccctcaaagccttctaagaacccacggctgagagactcccagagctccatgatggtccattcacactactccagagagtcggaagacagctcagaacctgctccttctgtagagctaggcggggaggaaccactacacgaagctttcaggtaggtggctcagaactctcatgcaggttcctccctcttcagtcattcacagcaagcccataggaaagacaaatgatccaggatgacctgccaccactgcaaccctttctgggaccctgGCCCAGGTCTTGTTTCTCATGGTTCTCTTTACTGGAGAAAGGTCACAGATAACATCAATTCACTCTTAGTCTCAACCACACTACTGGAAGAAGTTGGGAAGATAGAGCAAGTGCTGAGGAACCTGTTTCACAAGCACTAAGACCTGAGTTCCATCTCCAGAACCCATGT
This mutation is a 531 bp deletion beginning at Chromosome 8 position 84,159,196 bp and ending after 84,159,726 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44873 | TCA TGC CTG TAT TTT GGA AGC | Common | A | |||
| 44874 | CCC ATT TCC TTA TGT GGC TAT AC | Wild type Reverse | A | |||
| 44875 | TGA TGT TAT CTG TGA CCT TTC TCC | Mutant Reverse | A | |||
| 44876 | Fluorophore-1 | CCA CAG GGT AAG ATC CCA TCT | Quencher-1 | WT Probe | ||
| 44877 | Fluorophore-2 | AAG TTC ATA GCC CAG GTC TTG TT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44873 | 0.40 uM |
| 44874 | 0.40 uM |
| 44875 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.