For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:97324058-97324156 99bp CAGGCTCATACGTGTTTACTGT CTGATGGGATCACTGGAACA
Mut= 96 bp
Wt= 99 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGCCCGCCAGTGTGCCAGGACCTACCTCCTATACACTTGCATAAGAGTTTGATATTAAGTGTACCTTCTTACATCTCAGCCGTTGTGTAGATGCGACTGGAATGACCTTTCCTCTCAAGGCCAGCTCCAGCATGAACTCTtccgaagggtttctgtttacacgcacagttgctttctcgtggtgtcagagtatgccagggaagggttgtagaatgaatgtattacagtggaattagactttgatgttgtcaggggagaggatgtggccccacgtgctgtttccagaggcctagtctacgtagtggtgcatgagagctcaatccattccagaggaggagccaccgtccagcgccttggccagcgtggtccagcacctcccattggagcttatggatggtgtggtccggaacctcagcaatgatgatagtgtgacagactcccagatgctgactgccattagcaggtgggtgccgagggtcagtgggtggagatggggctgtcagcggttagaggtcaggctcatacgtgtttactgtgagctcgacagtctcaccctgtttggccttgggATAGATATAAGTAACACCAAATCCTGTTCCAGTGATCCCATCAGACTAGGTACTAGCTGTGTGACCCTGGAAACGCTGCTGAACTCTCGGCCTCAGTCTTCCCCTATAAAAGTAGAAGTAGATGGCAACATGAGAAAGTAAAAACAGGG
This mutation is a 429 bp deletion beginning at Chromosome 7 position 97,324,102 bp and ending after 97,324,530 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44719 | CAG GCT CAT ACG TGT TTA CTG T | Wild type Forward | A | |||
| 44720 | CTG ATG GGA TCA CTG GAA CA | Common | A | |||
| 44721 | AGA TGC GAC TGG AAT GAC CT | Mutant Forward | A | |||
| 44722 | Fluorophore-1 | AGC TCG ACA GTC TCA CCC TG | Quencher-1 | WT Probe | ||
| 44723 | Fluorophore-2 | CCA GCT CCA GCA TGA ACT CTA | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44719 | 0.40 uM |
| 44720 | 0.40 uM |
| 44721 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.