For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr7:142440520+142440605 86bp TCTCTGCTCAAGGCCTGATTC TCCTGCTCCTCTACCAGTCC
Mut= 95 bp
Wt= 86 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
AGGGGGTGGGGGGGTGCAAGGTTCAAGCTGGGGAGCTCAAGGCGGCCCTGGCAGGCCTTCTTCTCAGAGGAAGGAGATGAGCAGAGGTGATAGGGAACGAGTGATTCAGGAAGCAGGCAGATGTTGGTCCATGGTCcattggaagctacagtagtagcagtagtagcatatatgtcacattgaaggaagattggctggtctcagggagctgatctgtgttacaatagtccagatctctggttaaagattggtctcaatcatacttgcctgatctcccaccatccaccccaggttcaaccagatgtggactgcctagaaccctgctctggaggggaccaacagtggggtcgactcctgctgtcactagagtatgattttggaagccaggaggtaaggctcactcagcaggtccagaggctctgtggttgatggagaatgtgatgaatgaagagtcaggtagaggggagcaggggaaaagaacctcttgaccccaggctgagccaacccactggccctcagattagagtgggcctgaggcaggctggaaacctgaaggctgagggcacagcagacccctacgcctgggtcagtgtgtccacccagtctgggagaagacatgagacaaaggtgcaccgagggacgctctctcccatgtttgaagagacatgctgctttctggtaagtctagtctgggtagatagagtgggctggagccagggcagcaggacccagctcattaccctgtctgcaggtcccaccagcagagctgcccaaagccactctgaaggtgcagctgtgggacttcaagcggttttcagaacacgagccactgggtgagctccaactacccctgggcaccgtggaccttcaacatgtcctggagagctggtaccagctaggccctccagggaccactgaggtgagcctggctggtaggggcccgggatctacctgtaacatggggggaggacaaggtctgaatgctgtacctgctgagttcaaacccccaagggtaaggatgaccctcccagttgcagccccgtcttgttgcccatagcctgagcagatgggggagctgtgcttctcactacgctacgtgcccagctcaggcagcctgactgtggttgtactggaggctcggggtctgaatccggggcttgcaggtgagagctatacttttgtggacagcgagctggaccctcgtgtgcatgtatgggactcccttcttgaactttctcactcgtgcagaggcctacgtgaagatccagcttatgttaaaccagagaaaatggaagaagagcaaaacatcctccaagaaaggcacgactaccccctacttcaacgaggccttcgtcttcctggttcccgttagccagctccaggtagggagctgggaggaagggcagagtggcctgggacgttgtgccatgccaaactgacaaccatcccctctacatgtctgcagagtgtggacctggtgctggctgtctgggcccgtggtctgcagctccggactgagcctgtgggcaaagtgctgctgggttcccgggcttctggccaacccctacagcactgggcagacatgctggcccatgctcggcggcccatcgcccagtggcaccacctgcggtcccccagggaagtggatcgtgttctggccctgcagcctcgccttcccctgcttaggcctcgctcctgaaagcaccgcgggtctcagttttcccagatggagagctgtggatatttgtgcaggctcttcagatctctctgtaataaacaaattctctttcacactcacatgtcctgatggagccctgtgaggaggatctgagatacaaggcaggctacactttggcaccactgtcctctcaaggttggggtagggtgctctgaacagatttgccagtcctgggcctctctctgctcaaggcctgattcctaggcctttccctgaaaaacgggcacCACCCTCTCTGCCAGCCAGGACTGGTAGAGGAGCAGGAGGCTAGAGCTGGCTCTGTGAAGGCAAAGAGGGCAATTGAGGGGGAGTTGTGGGTAGGTACAGCTTGTGGAAAAGACCTCAAGACCATGAGGGACTGTGATACAGTG
This mutation is a 1829 bp deletion beginning at Chromosome 7 position 142,438,739 bp and ending after 142,440,567 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44709 | TCT CTG CTC AAG GCC TGA TTC | Wild type Forward | A | |||
| 44710 | TCC TGC TCC TCT ACC AGT CC | Common | A | |||
| 44711 | AGC AGA GGT GAT AGG GAA CG | Mutant Forward | A | |||
| 44712 | Fluorophore-1 | TCC CTG AAA AAC GGG CA | Quencher-1 | WT Probe | ||
| 44713 | Fluorophore-2 | CAG ATG TTG GTC CAT GGT CC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| ddH2O | |
| Kapa 2G HS buffer | 1.30 X |
| MgCl2 | 2.60 mM |
| dNTP KAPA | 0.26 mM |
| 44709 | 0.50 uM |
| 44710 | 0.50 uM |
| 44711 | 0.50 uM |
| Glycerol | 6.50 % |
| Dye | 1.00 X |
| Kapa 2G HS taq polym | 0.03 U/ul |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.