For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr18:58582442+58582535 94bp AATAAGAGGAAGGCCACCCAAG CTGACCCTGAAGTGCTCCTG
Mut= 101 bp
Wt= 94 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGCACATTCAATGCTATAGTAGTACACATGCAATTACTGATTTTGATTTCCATTCGACAAATCACAACAAGTACATTTGCTATCAATACTGCATGACTGCATTAAGACACGGATCTTAAAGGTCATGTTTCCAAATGAGTTTGTAACcagtgaccgaggatgtggcatgaaagcctggatctgttaggacatcactatcagctgtgtgccacgttaacttaatgccttttatcaatctcttcacataggcgccacgtgtgtgctaaagaagaaattctccgcaagccagttttggaatgattgcaagaagtacaacgtgactgtgtttcagtacattggggaactttgccgttatctgtgcaaacagcctcaggtaagagagtgttgctggagatgctaagggcttcagacagaatatgctttctttgcttttgctgtacaatgctccagaagagaatctatcaaacacacacaggtgttcatagtatacaggatagaagaaatataaaagtccaagaaaataagaggaaggccacccaaggaagtctcaataatacgctttgtcctgcagCAGGGCCAGGCAGATCCATAGTCAGGAGCACTTCAGGGTCAGGCCAATTCCAGTTTGATTGTGAAATTAGATGCATAGATTTACAGAAAAACAATTCCAAGTTGAACGCAGATAATGCCTTCTATATAAACCTG
This mutation is a 424 bp deletion beginning at Chromosome 18 position 58,582,070 bp and ending after 58,582,493 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44695 | AAT AAG AGG AAG GCC ACC CAA G | Wild type Forward | A | |||
| 44696 | CTG ACC CTG AAG TGC TCC TG | Common | A | |||
| 44697 | CTG CAT GAC TGC ATT AAG ACA C | Mutant Forward | A | |||
| 44698 | Fluorophore-1 | CAA TAA TAC GCT TTG TCC TGC A | Quencher-1 | WT Probe | ||
| 44699 | Fluorophore-2 | AAT GAG TTT GTA ACC AGG GCC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44695 | 0.40 uM |
| 44696 | 0.40 uM |
| 44697 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.