For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr3:138179333-138179433 101bp ATCTTCCTCACGGCGCTTC TGTGTATTGGGGAGGTAAACA
Mut= 95 bp
Wt= 101 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGAACAGGGCATCGGATCCCATTACAGATGGATGTGAGCCACCATGTGGTTGCTGGAATTTGAACTCAGGACCTCTGAAAGAGCAGTCAGTGCTCTTAACCACGGAGCCATCTCTCCAGCCCAAATGAACTTGTATAATGCTATTATACACAGTTTTACATCACAAGtttcctcacatgcacacataggtcagggctgagtttagatagactaggctatttcagcaactaattcataaagcattttgtgaataaaaaagcagtttgacttaatttaaatatattttcccaatttctttcagagccatgtagaaaatccagccagtgcttcaagacttccaaagacaatcccttggtgaaaaataaggtaaaaagctggctgcccacagccagctttgtagcttactctgacttctgacttctggcacttgatcttcctcacggcgcttctcagaagtctctttcctaccattttacagctctattaaagTACAGCTAAGGAGACACCAAATGTTTACCTCCCCAATACACAATTTGATGCACACTGACAAATACACATATACAACTCCCCCACCCCCGCCCCACCCCCAGGAAGCAGCACCCAAAACTGAAGTGTGCAGGTGTCTACCAACTCCATGGGTTTCCTCATGTGTGTCCCCAAAT
This mutation is a 322 bp deletion beginning at Chromosome 3 position 138,179,375 bp and ending after 138,179,696 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44684 | ATC TTC CTC ACG GCG CTT C | Wild type Forward | A | |||
| 44685 | TGT GTA TTG GGG AGG TAA ACA | Common | A | |||
| 44686 | TCC AGC CCA AAT GAA CTT GT | Mutant Forward | A | |||
| 44687 | Fluorophore-1 | AGT CTC TTT CCT ACC ATT TTA CAG CTC | Quencher-1 | WT Probe | ||
| 44688 | Fluorophore-2 | AGT TTT ACA TCA CAA GTA CAG CTA AGG A | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44684 | 0.40 uM |
| 44685 | 0.40 uM |
| 44686 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.