For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr5:129978374+129978501 128bp GCGCAAATCAGTCATGGA CCAGTAACCCTATATTTGAGATTCC
Mut= 130 bp
Wt= 128 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
GGCTTTCCCTTGCAAATGCTAATACTGTCAGTAAAGAAACAGGGTGCCTACCTTAGGAAAAGAAAGTTTAGAGAGTCTTAGGTGGAAATACAGAGCTTTTAGGGATATTTGTATTAAACCATCAATATAATTCAGACACAGTACAGAAATCTAATGTTTGGCCTTACCCTtgcgcaaatcagtcatggaaaaaaagatatttaagtgttttgcaaacatagttgattgtggaattggataatattctcaaataattttacatttaaaaaattagggaatctcaaatatagggttactggttttccttattttacagatggggtcgaggatttggtcttttgggttccatttttggaaaagatggtgtattaaaccagccaaacagtgtctttggacttatattttatatactacagttattacttggtaagtattgatacagagatacagaaataagcttgttatacccattcagtgcttgtgtcttcaccctagTGTGTCTTCATAGTAAACGTACACGCTAGTAATAGAGAACCACGAGAGTGAAGTGTGAGTCACTGCTGCTTATCATGTGTTGACCTTGGTATCAGTGGACGTTTAGTCATGGCTAGTAGTGTGTCATGATGTCCAGAAACCCAGCCACATTCATGGAAATT
This mutation is a 325 bp deletion beginning at Chromosome 5 position 129,978,373 bp and ending after 129,978,697 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44580 | GCG CAA ATC AGT CAT GGA | Wild type Forward | A | |||
| 44581 | CCA GTA ACC CTA TAT TTG AGA TTC C | Wild type Reverse | A | |||
| 44582 | GTG GAA ATA CAG AGC TTT TAG GG | Mutant Forward | A | |||
| 44583 | GGT TCT CTA TTA CTA GCG TGT ACG TTT | Mutant Reverse | A | |||
| 44585 | Fluorophore-1 | AAA CAT AGT TGA TTG TGG AAT TGG A | Quencher-1 | WT Probe | ||
| 44587 | Fluorophore-2 | CTA ATG TTT GGC CTT ACC CTT GT | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44580 | 0.40 uM |
| 44581 | 0.40 uM |
| 44582 | 0.40 uM |
| 44583 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.