For in-depth product & services help, ask our
Technical Information Scientists
Notes
Taqman qPCR protocols are run on a real time PCR instrument. Use an appropriate instrument specific Fluorophore/Quencher combination.
The genotyping protocol(s) presented here have been optimized for reagents and conditions used by The Jackson Laboratory (JAX).
To genotype animals, JAX recommends researchers validate the assay independently upon receipt of animals into their facility.
Reaction cycling temperature and times may require additional optimization based on the specific genotyping reagents used.
Expected Results
>chr11:5534128-5534235 108bp CACAGCTGGTGCTGACACCT TTCTGTTCCCTAGTCTCCATGC
Mut= 113 bp
Wt= 108 bp
Fam=Mut
Hex=Wt
Sequence
Wt Sequence (deletion in lower case):
TGAAACTTAAACATAAAATAAATGGATGTTTTTTAACTAAATGAGTTTTAGCTGGGCCTGGTAAGCTCTCTCCTCAGTCCCAGCACTCTAGGCAGAAGCAGGCAGAACTCTGAATGAGGCCAGACATAGATACAGAGTGAGACTTTGTCCCAAAAATATATCTTTTTTAATTCGTTAGAGAAATgtcttacatttcgtctataatggattgcttttcttccttccctctcttcccgctgctttcctcctcctaggtgtccagtaagaaagaaacgactgactgaagctgaactcggtgcagttactgatgaatgggctctcggcgcacatcagggaagagaaggtcatggggtaaacacgtgtcctagcagcctttctatgcccagcatgctagatgtggtctgtgaggaaatggatcagacaactggagaaccacagtgtgaagtcgcccgaaggcggctgcaagagattgaggacaggtactgactgcgcgtcacatgtgctgtggtcctgtgtcagctctcctctcctaggctgctcggggtcacgtcctggtgctggagatggggaatgaacaacagacacttagtggtagatggaatagagcttgactaagccttttactgaccgtgtcaagctccgttttcctggacacttcttctaacttgactctattccaaacctttctcggtgaaaaacagcctcatttggccacttttctcagagttgtagcttacatgatctctcgctgcagcacctgtgggtttttcttttagtttcaaattttgtttgttcatttgctacaagaaacacacagtgccttgagtgattttttttttttctttctccaatttattatttaggataattgacgaagatgaagaggttgaaagtgacagaaatgttagccacctcccaagtcttgtcctttctgacaccatgaaaacgggtttgaagagggaatttgatgaagtcttcacaaagaggatgattgagtctatgtaagtgcacagctggtgctgacacctgggaaggctcttgccaagcctgttctcttaaagctgggggggGACAGCAGCAGCCACTCAGGCTCAGCATGGAGACTAGGGAACAGAAGGTGATGTGTCAGATTAGTGACAGTTGACATTGCTATCACGAAGCCCACAAACTAGCACAGCCGTCTGTGGTCATTTTAGTGTTTTAACTCTTGGATTTGTTTTG
This mutation is an 886 bp deletion beginning at Chromosome 11 position 5,534,174 bp and ending after 5,535,059 bp (GRCm38/mm10).
JAX Protocol
Protocol Primers
| Primer | 5' Label | Sequence 5' → 3' | 3' Label | Primer Type | Reaction | Note |
|---|---|---|---|---|---|---|
| 44556 | CAC AGC TGG TGC TGA CAC CT | Wild type Forward | A | |||
| 44557 | TTC TGT TCC CTA GTC TCC ATG C | Common | A | |||
| 44558 | GGC CAG ACA TAG ATA CAG AGT GAG | Mutant Forward | A | |||
| 44559 | Fluorophore-1 | AAG GCT CTT GCC AAG CCT | Quencher-1 | WT Probe | ||
| 44560 | Fluorophore-2 | TTC GTT AGA GAA ATG ACA GCA GC | Quencher-2 | MUT Probe |
Reaction A
| Component | Final Concentration |
|---|---|
| Kapa Probe Fast QPCR | 1.00 X |
| ddH2O | |
| 44556 | 0.40 uM |
| 44557 | 0.40 uM |
| 44558 | 0.40 uM |
| Wt Probe | 0.15 uM |
| Mutant Probe | 0.15 uM |
| DNA |
Cycling
| Step | Temp °C | Time | Note |
|---|---|---|---|
| 1 | 95.0 | -- | |
| 2 | 95.0 | -- | |
| 3 | 60.0 | -- | |
| 4 | -- | repeat steps 2-3 for 40 cycles | |
| 5 | 40.0 | -- | Forever |
JAX uses a very high speed Taq (~1000 bp/sec), use cycling times recommended for your reagents.
Strains Using This Protocol
This is the only strain that uses this protocol.